ID: 1107411145

View in Genome Browser
Species Human (GRCh38)
Location 13:40159833-40159855
Sequence GACTGTGCTCTGGGTGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107411145_1107411150 -6 Left 1107411145 13:40159833-40159855 CCAAAGACACCCAGAGCACAGTC No data
Right 1107411150 13:40159850-40159872 ACAGTCCCTCTAGGCTCTGCGGG No data
1107411145_1107411149 -7 Left 1107411145 13:40159833-40159855 CCAAAGACACCCAGAGCACAGTC No data
Right 1107411149 13:40159849-40159871 CACAGTCCCTCTAGGCTCTGCGG No data
1107411145_1107411153 9 Left 1107411145 13:40159833-40159855 CCAAAGACACCCAGAGCACAGTC No data
Right 1107411153 13:40159865-40159887 TCTGCGGGCCTCAAGCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107411145 Original CRISPR GACTGTGCTCTGGGTGTCTT TGG (reversed) Intergenic