ID: 1107411149

View in Genome Browser
Species Human (GRCh38)
Location 13:40159849-40159871
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107411144_1107411149 2 Left 1107411144 13:40159824-40159846 CCTGTGTCACCAAAGACACCCAG No data
Right 1107411149 13:40159849-40159871 CACAGTCCCTCTAGGCTCTGCGG No data
1107411145_1107411149 -7 Left 1107411145 13:40159833-40159855 CCAAAGACACCCAGAGCACAGTC No data
Right 1107411149 13:40159849-40159871 CACAGTCCCTCTAGGCTCTGCGG No data
1107411143_1107411149 8 Left 1107411143 13:40159818-40159840 CCATTGCCTGTGTCACCAAAGAC 0: 1
1: 0
2: 0
3: 22
4: 266
Right 1107411149 13:40159849-40159871 CACAGTCCCTCTAGGCTCTGCGG No data
1107411140_1107411149 25 Left 1107411140 13:40159801-40159823 CCCAGCGAGTGCTCAGCCCATTG No data
Right 1107411149 13:40159849-40159871 CACAGTCCCTCTAGGCTCTGCGG No data
1107411142_1107411149 9 Left 1107411142 13:40159817-40159839 CCCATTGCCTGTGTCACCAAAGA No data
Right 1107411149 13:40159849-40159871 CACAGTCCCTCTAGGCTCTGCGG No data
1107411141_1107411149 24 Left 1107411141 13:40159802-40159824 CCAGCGAGTGCTCAGCCCATTGC No data
Right 1107411149 13:40159849-40159871 CACAGTCCCTCTAGGCTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107411149 Original CRISPR CACAGTCCCTCTAGGCTCTG CGG Intergenic