ID: 1107411150

View in Genome Browser
Species Human (GRCh38)
Location 13:40159850-40159872
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107411141_1107411150 25 Left 1107411141 13:40159802-40159824 CCAGCGAGTGCTCAGCCCATTGC No data
Right 1107411150 13:40159850-40159872 ACAGTCCCTCTAGGCTCTGCGGG No data
1107411145_1107411150 -6 Left 1107411145 13:40159833-40159855 CCAAAGACACCCAGAGCACAGTC No data
Right 1107411150 13:40159850-40159872 ACAGTCCCTCTAGGCTCTGCGGG No data
1107411140_1107411150 26 Left 1107411140 13:40159801-40159823 CCCAGCGAGTGCTCAGCCCATTG No data
Right 1107411150 13:40159850-40159872 ACAGTCCCTCTAGGCTCTGCGGG No data
1107411143_1107411150 9 Left 1107411143 13:40159818-40159840 CCATTGCCTGTGTCACCAAAGAC No data
Right 1107411150 13:40159850-40159872 ACAGTCCCTCTAGGCTCTGCGGG No data
1107411142_1107411150 10 Left 1107411142 13:40159817-40159839 CCCATTGCCTGTGTCACCAAAGA No data
Right 1107411150 13:40159850-40159872 ACAGTCCCTCTAGGCTCTGCGGG No data
1107411144_1107411150 3 Left 1107411144 13:40159824-40159846 CCTGTGTCACCAAAGACACCCAG No data
Right 1107411150 13:40159850-40159872 ACAGTCCCTCTAGGCTCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107411150 Original CRISPR ACAGTCCCTCTAGGCTCTGC GGG Intergenic