ID: 1107411153

View in Genome Browser
Species Human (GRCh38)
Location 13:40159865-40159887
Sequence TCTGCGGGCCTCAAGCCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107411147_1107411153 0 Left 1107411147 13:40159842-40159864 CCCAGAGCACAGTCCCTCTAGGC No data
Right 1107411153 13:40159865-40159887 TCTGCGGGCCTCAAGCCATAAGG No data
1107411143_1107411153 24 Left 1107411143 13:40159818-40159840 CCATTGCCTGTGTCACCAAAGAC No data
Right 1107411153 13:40159865-40159887 TCTGCGGGCCTCAAGCCATAAGG No data
1107411144_1107411153 18 Left 1107411144 13:40159824-40159846 CCTGTGTCACCAAAGACACCCAG No data
Right 1107411153 13:40159865-40159887 TCTGCGGGCCTCAAGCCATAAGG No data
1107411148_1107411153 -1 Left 1107411148 13:40159843-40159865 CCAGAGCACAGTCCCTCTAGGCT No data
Right 1107411153 13:40159865-40159887 TCTGCGGGCCTCAAGCCATAAGG No data
1107411142_1107411153 25 Left 1107411142 13:40159817-40159839 CCCATTGCCTGTGTCACCAAAGA No data
Right 1107411153 13:40159865-40159887 TCTGCGGGCCTCAAGCCATAAGG No data
1107411145_1107411153 9 Left 1107411145 13:40159833-40159855 CCAAAGACACCCAGAGCACAGTC No data
Right 1107411153 13:40159865-40159887 TCTGCGGGCCTCAAGCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107411153 Original CRISPR TCTGCGGGCCTCAAGCCATA AGG Intergenic