ID: 1107411889

View in Genome Browser
Species Human (GRCh38)
Location 13:40165533-40165555
Sequence CCCCCGATGTCAGAAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107411881_1107411889 12 Left 1107411881 13:40165498-40165520 CCAGAGATGACACATGCCCTCTC No data
Right 1107411889 13:40165533-40165555 CCCCCGATGTCAGAAAAGACAGG No data
1107411880_1107411889 22 Left 1107411880 13:40165488-40165510 CCTCAACAAACCAGAGATGACAC No data
Right 1107411889 13:40165533-40165555 CCCCCGATGTCAGAAAAGACAGG No data
1107411884_1107411889 -4 Left 1107411884 13:40165514-40165536 CCCTCTCCCACACTGGGAGCCCC No data
Right 1107411889 13:40165533-40165555 CCCCCGATGTCAGAAAAGACAGG No data
1107411886_1107411889 -10 Left 1107411886 13:40165520-40165542 CCCACACTGGGAGCCCCCGATGT No data
Right 1107411889 13:40165533-40165555 CCCCCGATGTCAGAAAAGACAGG No data
1107411885_1107411889 -5 Left 1107411885 13:40165515-40165537 CCTCTCCCACACTGGGAGCCCCC No data
Right 1107411889 13:40165533-40165555 CCCCCGATGTCAGAAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107411889 Original CRISPR CCCCCGATGTCAGAAAAGAC AGG Intergenic
No off target data available for this crispr