ID: 1107417313

View in Genome Browser
Species Human (GRCh38)
Location 13:40212581-40212603
Sequence AGTAAGCACAGAGTCTGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107417313_1107417318 7 Left 1107417313 13:40212581-40212603 CCCCGACAGACTCTGTGCTTACT No data
Right 1107417318 13:40212611-40212633 CAGCCTGAAACTCTCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107417313 Original CRISPR AGTAAGCACAGAGTCTGTCG GGG (reversed) Intergenic