ID: 1107421119

View in Genome Browser
Species Human (GRCh38)
Location 13:40247735-40247757
Sequence TGCCTGACAAAACTCCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107421119_1107421121 14 Left 1107421119 13:40247735-40247757 CCATTTTGGAGTTTTGTCAGGCA No data
Right 1107421121 13:40247772-40247794 AGAGAAGAAAAGAGAGCTAATGG No data
1107421119_1107421120 -9 Left 1107421119 13:40247735-40247757 CCATTTTGGAGTTTTGTCAGGCA No data
Right 1107421120 13:40247749-40247771 TGTCAGGCAAATTAAACAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107421119 Original CRISPR TGCCTGACAAAACTCCAAAA TGG (reversed) Intergenic
No off target data available for this crispr