ID: 1107427413

View in Genome Browser
Species Human (GRCh38)
Location 13:40307682-40307704
Sequence ATAATACCACCTTTGAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107427413_1107427414 -7 Left 1107427413 13:40307682-40307704 CCAGCTTTCAAAGGTGGTATTAT No data
Right 1107427414 13:40307698-40307720 GTATTATTAACAGCACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107427413 Original CRISPR ATAATACCACCTTTGAAAGC TGG (reversed) Intergenic
No off target data available for this crispr