ID: 1107430063

View in Genome Browser
Species Human (GRCh38)
Location 13:40332468-40332490
Sequence CAGAAGTACCAGAGGCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107430056_1107430063 -2 Left 1107430056 13:40332447-40332469 CCCCAGTTTATAGCCAGTGGTCA No data
Right 1107430063 13:40332468-40332490 CAGAAGTACCAGAGGCCTTGGGG No data
1107430058_1107430063 -4 Left 1107430058 13:40332449-40332471 CCAGTTTATAGCCAGTGGTCAGA No data
Right 1107430063 13:40332468-40332490 CAGAAGTACCAGAGGCCTTGGGG No data
1107430054_1107430063 21 Left 1107430054 13:40332424-40332446 CCTGAGGAAGGGGGTCATGGGCA No data
Right 1107430063 13:40332468-40332490 CAGAAGTACCAGAGGCCTTGGGG No data
1107430057_1107430063 -3 Left 1107430057 13:40332448-40332470 CCCAGTTTATAGCCAGTGGTCAG No data
Right 1107430063 13:40332468-40332490 CAGAAGTACCAGAGGCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107430063 Original CRISPR CAGAAGTACCAGAGGCCTTG GGG Intergenic
No off target data available for this crispr