ID: 1107432209

View in Genome Browser
Species Human (GRCh38)
Location 13:40350303-40350325
Sequence CTGGTAAGAAAGATGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107432205_1107432209 -1 Left 1107432205 13:40350281-40350303 CCAGAGGAGCTCCGATGGTATTC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1107432209 13:40350303-40350325 CTGGTAAGAAAGATGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107432209 Original CRISPR CTGGTAAGAAAGATGAGACA GGG Intergenic
No off target data available for this crispr