ID: 1107432209 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:40350303-40350325 |
| Sequence | CTGGTAAGAAAGATGAGACA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1107432205_1107432209 | -1 | Left | 1107432205 | 13:40350281-40350303 | CCAGAGGAGCTCCGATGGTATTC | 0: 1 1: 0 2: 0 3: 2 4: 40 |
||
| Right | 1107432209 | 13:40350303-40350325 | CTGGTAAGAAAGATGAGACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1107432209 | Original CRISPR | CTGGTAAGAAAGATGAGACA GGG | Intergenic | ||
| No off target data available for this crispr | |||||