ID: 1107432564

View in Genome Browser
Species Human (GRCh38)
Location 13:40352979-40353001
Sequence TGCCCACAGCTGCCCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107432557_1107432564 25 Left 1107432557 13:40352931-40352953 CCCTGGCATTCCTTCCTCATGCA No data
Right 1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG No data
1107432560_1107432564 15 Left 1107432560 13:40352941-40352963 CCTTCCTCATGCAGTGTGGAAAT No data
Right 1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG No data
1107432554_1107432564 30 Left 1107432554 13:40352926-40352948 CCCTCCCCTGGCATTCCTTCCTC No data
Right 1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG No data
1107432561_1107432564 11 Left 1107432561 13:40352945-40352967 CCTCATGCAGTGTGGAAATCAGT No data
Right 1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG No data
1107432555_1107432564 29 Left 1107432555 13:40352927-40352949 CCTCCCCTGGCATTCCTTCCTCA No data
Right 1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG No data
1107432556_1107432564 26 Left 1107432556 13:40352930-40352952 CCCCTGGCATTCCTTCCTCATGC No data
Right 1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG No data
1107432558_1107432564 24 Left 1107432558 13:40352932-40352954 CCTGGCATTCCTTCCTCATGCAG No data
Right 1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107432564 Original CRISPR TGCCCACAGCTGCCCCAGCC TGG Intergenic
No off target data available for this crispr