ID: 1107436466

View in Genome Browser
Species Human (GRCh38)
Location 13:40384764-40384786
Sequence GAGGCCAAGGCAGGATCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107436466_1107436470 -10 Left 1107436466 13:40384764-40384786 CCTCGTGATCCTGCCTTGGCCTC No data
Right 1107436470 13:40384777-40384799 CCTTGGCCTCCCAAAGTGCTGGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
1107436466_1107436475 17 Left 1107436466 13:40384764-40384786 CCTCGTGATCCTGCCTTGGCCTC No data
Right 1107436475 13:40384804-40384826 CAGGCGTGAGCCACTGCACCTGG 0: 6711
1: 37182
2: 93253
3: 125732
4: 132871
1107436466_1107436472 -2 Left 1107436466 13:40384764-40384786 CCTCGTGATCCTGCCTTGGCCTC No data
Right 1107436472 13:40384785-40384807 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107436466 Original CRISPR GAGGCCAAGGCAGGATCACG AGG (reversed) Intergenic
No off target data available for this crispr