ID: 1107437095

View in Genome Browser
Species Human (GRCh38)
Location 13:40389754-40389776
Sequence CAGGCTAAGGATGCAGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107437095_1107437100 19 Left 1107437095 13:40389754-40389776 CCAGTTCCTGCATCCTTAGCCTG No data
Right 1107437100 13:40389796-40389818 AATTTGCAGCAAAGTTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107437095 Original CRISPR CAGGCTAAGGATGCAGGAAC TGG (reversed) Intergenic
No off target data available for this crispr