ID: 1107445950

View in Genome Browser
Species Human (GRCh38)
Location 13:40470555-40470577
Sequence CACAGTCACCTGCCTTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107445950_1107445952 2 Left 1107445950 13:40470555-40470577 CCCAAGGAAGGCAGGTGACTGTG No data
Right 1107445952 13:40470580-40470602 GCCGAGCCCAGCTGAAAGAATGG No data
1107445950_1107445955 8 Left 1107445950 13:40470555-40470577 CCCAAGGAAGGCAGGTGACTGTG No data
Right 1107445955 13:40470586-40470608 CCCAGCTGAAAGAATGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107445950 Original CRISPR CACAGTCACCTGCCTTCCTT GGG (reversed) Intergenic
No off target data available for this crispr