ID: 1107447322

View in Genome Browser
Species Human (GRCh38)
Location 13:40480693-40480715
Sequence GCCACGGTGCCCAGAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107447322_1107447335 22 Left 1107447322 13:40480693-40480715 CCTCCCTCTCTGGGCACCGTGGC No data
Right 1107447335 13:40480738-40480760 TAACCGCTGTGTAGCCTGACAGG No data
1107447322_1107447336 23 Left 1107447322 13:40480693-40480715 CCTCCCTCTCTGGGCACCGTGGC No data
Right 1107447336 13:40480739-40480761 AACCGCTGTGTAGCCTGACAGGG No data
1107447322_1107447327 -10 Left 1107447322 13:40480693-40480715 CCTCCCTCTCTGGGCACCGTGGC No data
Right 1107447327 13:40480706-40480728 GCACCGTGGCACACCCTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107447322 Original CRISPR GCCACGGTGCCCAGAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr