ID: 1107451578

View in Genome Browser
Species Human (GRCh38)
Location 13:40515021-40515043
Sequence GTGCTGGTCCCCTCTTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107451574_1107451578 5 Left 1107451574 13:40514993-40515015 CCAATCACGTGGCTCTATCCAAC No data
Right 1107451578 13:40515021-40515043 GTGCTGGTCCCCTCTTGCTGTGG No data
1107451570_1107451578 16 Left 1107451570 13:40514982-40515004 CCATTCTTGCCCCAATCACGTGG No data
Right 1107451578 13:40515021-40515043 GTGCTGGTCCCCTCTTGCTGTGG No data
1107451572_1107451578 7 Left 1107451572 13:40514991-40515013 CCCCAATCACGTGGCTCTATCCA No data
Right 1107451578 13:40515021-40515043 GTGCTGGTCCCCTCTTGCTGTGG No data
1107451573_1107451578 6 Left 1107451573 13:40514992-40515014 CCCAATCACGTGGCTCTATCCAA No data
Right 1107451578 13:40515021-40515043 GTGCTGGTCCCCTCTTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107451578 Original CRISPR GTGCTGGTCCCCTCTTGCTG TGG Intergenic
No off target data available for this crispr