ID: 1107452436

View in Genome Browser
Species Human (GRCh38)
Location 13:40522033-40522055
Sequence CTCTTCCCCCAGTAGCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107452429_1107452436 22 Left 1107452429 13:40521988-40522010 CCTGCCTCAGTGTTTTTGCCCTT No data
Right 1107452436 13:40522033-40522055 CTCTTCCCCCAGTAGCCACATGG No data
1107452428_1107452436 27 Left 1107452428 13:40521983-40522005 CCACTCCTGCCTCAGTGTTTTTG No data
Right 1107452436 13:40522033-40522055 CTCTTCCCCCAGTAGCCACATGG No data
1107452434_1107452436 3 Left 1107452434 13:40522007-40522029 CCTTGAGGTTTCTTCTGCCTGGA No data
Right 1107452436 13:40522033-40522055 CTCTTCCCCCAGTAGCCACATGG No data
1107452432_1107452436 4 Left 1107452432 13:40522006-40522028 CCCTTGAGGTTTCTTCTGCCTGG No data
Right 1107452436 13:40522033-40522055 CTCTTCCCCCAGTAGCCACATGG No data
1107452430_1107452436 18 Left 1107452430 13:40521992-40522014 CCTCAGTGTTTTTGCCCTTGAGG No data
Right 1107452436 13:40522033-40522055 CTCTTCCCCCAGTAGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107452436 Original CRISPR CTCTTCCCCCAGTAGCCACA TGG Intergenic
No off target data available for this crispr