ID: 1107453563

View in Genome Browser
Species Human (GRCh38)
Location 13:40534724-40534746
Sequence GTTTTCCTGAAGAGGAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107453563_1107453567 3 Left 1107453563 13:40534724-40534746 CCCAGACTCCTCTTCAGGAAAAC No data
Right 1107453567 13:40534750-40534772 AATAAAAACACCTTCCTTGCAGG No data
1107453563_1107453572 26 Left 1107453563 13:40534724-40534746 CCCAGACTCCTCTTCAGGAAAAC No data
Right 1107453572 13:40534773-40534795 ACAGATGCAGGGATTAAATGAGG No data
1107453563_1107453569 14 Left 1107453563 13:40534724-40534746 CCCAGACTCCTCTTCAGGAAAAC No data
Right 1107453569 13:40534761-40534783 CTTCCTTGCAGGACAGATGCAGG No data
1107453563_1107453570 15 Left 1107453563 13:40534724-40534746 CCCAGACTCCTCTTCAGGAAAAC No data
Right 1107453570 13:40534762-40534784 TTCCTTGCAGGACAGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107453563 Original CRISPR GTTTTCCTGAAGAGGAGTCT GGG (reversed) Intergenic
No off target data available for this crispr