ID: 1107455921

View in Genome Browser
Species Human (GRCh38)
Location 13:40554421-40554443
Sequence GAGCACCACTAGATGATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 50}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107455917_1107455921 1 Left 1107455917 13:40554397-40554419 CCTTCATACACCTGGGCCCAGAA 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1107455921 13:40554421-40554443 GAGCACCACTAGATGATACAAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1107455914_1107455921 12 Left 1107455914 13:40554386-40554408 CCAGGAATATACCTTCATACACC 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1107455921 13:40554421-40554443 GAGCACCACTAGATGATACAAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1107455913_1107455921 16 Left 1107455913 13:40554382-40554404 CCTACCAGGAATATACCTTCATA 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1107455921 13:40554421-40554443 GAGCACCACTAGATGATACAAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1107455918_1107455921 -9 Left 1107455918 13:40554407-40554429 CCTGGGCCCAGAATGAGCACCAC 0: 1
1: 0
2: 0
3: 29
4: 159
Right 1107455921 13:40554421-40554443 GAGCACCACTAGATGATACAAGG 0: 1
1: 0
2: 0
3: 9
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107455921 Original CRISPR GAGCACCACTAGATGATACA AGG Intergenic
913397664 1:118389869-118389891 GAGCACCACTAGCTATTACCAGG - Intergenic
915092619 1:153437089-153437111 GACCACCACAAGATAATGCATGG - Exonic
922778339 1:228228151-228228173 GAGTACCCCTAGATTATAAAAGG + Intronic
1063638581 10:7809481-7809503 GAGCACCACTAAAGGCTACAGGG - Intergenic
1063939558 10:11113350-11113372 TACCACCACTAGATGGTGCATGG + Intronic
1066513947 10:36134223-36134245 GAGCAGCACTAGATGCTGCAGGG - Intergenic
1069334627 10:67333794-67333816 GAGGTCTACTAGATTATACATGG + Intronic
1072166549 10:92818900-92818922 GAGACCAACTAGAAGATACAAGG - Intergenic
1072950461 10:99842560-99842582 CAGCATGACTAGAGGATACATGG + Intronic
1074590227 10:114805812-114805834 GAGGACCACTAGAAGAAATACGG + Intergenic
1078562028 11:12380507-12380529 CAGCACCAGTAGGTGATGCACGG - Intronic
1087811681 11:102615518-102615540 GAGCACATCTAGATGATAACTGG - Intronic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1104488182 12:129170121-129170143 GAGCAGCTCTAGATGAGAAAGGG - Intronic
1105738987 13:23301924-23301946 GAACACTACTTGATGATAAAAGG + Intronic
1107455921 13:40554421-40554443 GAGCACCACTAGATGATACAAGG + Intergenic
1109992040 13:70071269-70071291 GAGCAGCACTACATGATAAAAGG + Intronic
1115485972 14:33911641-33911663 CAGCACCAATAAATGAGACATGG - Intergenic
1119928884 14:78525071-78525093 GAGAAGCTCTAGATGTTACATGG + Intronic
1126521806 15:49604232-49604254 TATCACCACTAGATGCTAAAGGG - Intronic
1130929678 15:88414718-88414740 GAGCAAAAACAGATGATACAAGG + Intergenic
1139077997 16:63478301-63478323 TTGCACCACCAGATCATACATGG + Intergenic
1142854357 17:2721681-2721703 GAGCACCTGTAGCAGATACAGGG - Intergenic
1149157124 17:53645127-53645149 GAGCACCATAAAATGATACAGGG - Intergenic
1151901131 17:77016069-77016091 GGGCAGCACTCCATGATACATGG - Intergenic
1158595110 18:58809117-58809139 AAGCAGGACTAGATAATACAGGG + Intergenic
1165860922 19:38908945-38908967 GAGCAGCACTTGATGTGACAGGG - Intergenic
925483570 2:4303457-4303479 GAGCACCACTAGATCATTGATGG - Intergenic
928531218 2:32193703-32193725 GAGCAACAGTAGATGGGACATGG + Intronic
932275804 2:70451391-70451413 GAGCACCTCTAGAAGAACCATGG - Intronic
934107340 2:88707591-88707613 GAGTACCACCAGAGGATACTTGG - Intronic
939749457 2:146024232-146024254 TATCACCTCTAGATGATACATGG + Intergenic
940280815 2:151987869-151987891 GAACACCAGAAAATGATACATGG - Intronic
941536884 2:166734417-166734439 GAGCACTAGTAAATTATACAAGG + Intergenic
1178965962 21:37118171-37118193 GAGCAAAAGTAGATCATACAGGG + Intronic
1181792164 22:25277036-25277058 GAGCATCTCTACATCATACAGGG - Intergenic
1181813067 22:25416279-25416301 GAGCATCTCTACATCATACAGGG - Intergenic
1181831045 22:25560470-25560492 GAGCATCTCTACATCATACAGGG - Intergenic
957518089 3:81282186-81282208 GATTAACACTAGATTATACATGG + Intergenic
963171314 3:142253941-142253963 GAGCACAAATAGATGATCCAAGG + Intergenic
967042200 3:185704134-185704156 GAGCTCCATCAGATGATAAAAGG + Intronic
969980465 4:11149310-11149332 GCGCACCACGAGATGATATCCGG - Intergenic
971496489 4:27271507-27271529 GAGCACCCTCAGATGATACTAGG - Intergenic
977745490 4:100541873-100541895 GGGCAGCTCTAGATTATACATGG + Intronic
983329365 4:166304577-166304599 GAGCACAAATAGATGATCTAAGG + Intergenic
1001001149 5:168008322-168008344 GAGCAAGACCAGATGATAGATGG + Intronic
1005706803 6:28463180-28463202 CAGCAACACTAGATGTTAAAAGG + Intergenic
1010602412 6:77846497-77846519 GAGAAACAGTAAATGATACAAGG - Intronic
1016209422 6:141510316-141510338 GAGCTCCACTAGAGCTTACACGG + Intergenic
1016626101 6:146171547-146171569 AAGCTTCACTAGATGATGCATGG + Intronic
1024637852 7:51305025-51305047 CAGCACCACTAGGTAATACAAGG + Intronic
1026504165 7:70968108-70968130 GAGCTCCAAAAAATGATACATGG - Intergenic
1032779666 7:135154348-135154370 GAGCAGAACTAAATGAAACAGGG - Intronic
1034672558 7:152869501-152869523 GAGCACCACGAGGTGGTAGACGG - Intergenic
1037932450 8:22890003-22890025 GAGCACCACCAGATGTTACCTGG + Intronic
1045254428 8:100507946-100507968 AAGCATCACAAGATGATATAAGG - Intergenic
1055216482 9:73869729-73869751 AAGCACAACTAGATTATAAATGG + Intergenic
1057500965 9:95596456-95596478 GACTTCCACTAGATCATACACGG - Intergenic
1189393225 X:40595704-40595726 AAGCACCTATAGATGATTCAGGG + Intronic
1200595783 Y:5138310-5138332 GAGCACAAATAGATGATCTAAGG + Intronic