ID: 1107456407

View in Genome Browser
Species Human (GRCh38)
Location 13:40559769-40559791
Sequence GGCACTCATCTGCATGGGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 2, 1: 0, 2: 1, 3: 10, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107456391_1107456407 26 Left 1107456391 13:40559720-40559742 CCATTCTGCCATAGCCATTGCAG 0: 1
1: 0
2: 1
3: 30
4: 210
Right 1107456407 13:40559769-40559791 GGCACTCATCTGCATGGGGTGGG 0: 2
1: 0
2: 1
3: 10
4: 173
1107456392_1107456407 18 Left 1107456392 13:40559728-40559750 CCATAGCCATTGCAGCTGCTCAC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1107456407 13:40559769-40559791 GGCACTCATCTGCATGGGGTGGG 0: 2
1: 0
2: 1
3: 10
4: 173
1107456390_1107456407 27 Left 1107456390 13:40559719-40559741 CCCATTCTGCCATAGCCATTGCA 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1107456407 13:40559769-40559791 GGCACTCATCTGCATGGGGTGGG 0: 2
1: 0
2: 1
3: 10
4: 173
1107456395_1107456407 12 Left 1107456395 13:40559734-40559756 CCATTGCAGCTGCTCACGGAGGA 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1107456407 13:40559769-40559791 GGCACTCATCTGCATGGGGTGGG 0: 2
1: 0
2: 1
3: 10
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107456407 Original CRISPR GGCACTCATCTGCATGGGGT GGG Exonic
901322388 1:8347819-8347841 GGCACTCAGCGGCATGAGGCTGG - Intergenic
901506339 1:9688148-9688170 GGAGCTCATCTGCCTGGGATGGG + Intronic
901911325 1:12460913-12460935 GGCACTTTTCTTTATGGGGTTGG - Intronic
902690100 1:18105760-18105782 GGCCCTCATCTCCAAGGGCTGGG + Intergenic
902932461 1:19741056-19741078 GCCACTCATTGGCAGGGGGTGGG - Intronic
906049487 1:42858569-42858591 GGCAGTCATCAGCATGAGATTGG - Intergenic
914676479 1:149910542-149910564 GGGGCTGAGCTGCATGGGGTGGG - Intronic
915231381 1:154448158-154448180 GGAGCTCACCTGCATGGGGGTGG - Exonic
916242041 1:162650031-162650053 GGGGCTCATCTGCATGGGGTGGG - Intronic
917989720 1:180361677-180361699 GGCATTTATCTGCATGGCTTGGG - Intronic
920849332 1:209618023-209618045 GGCCCTCCACTGCATGGGCTCGG + Exonic
923435558 1:233964759-233964781 GGAACTCATCAGCATGGCATAGG - Intronic
924036934 1:239947157-239947179 GGCACTCATCTGCATGATTAAGG + Intergenic
1063767685 10:9160988-9161010 GGCACACTGGTGCATGGGGTGGG - Intergenic
1065084885 10:22164354-22164376 GGCTGCCATCTGCATGGGGCTGG + Intergenic
1069856538 10:71444068-71444090 GGCACTCATTTGCCTCGGCTGGG + Intronic
1070173037 10:73946985-73947007 GGCACTCTGATGCATGTGGTGGG + Intergenic
1071486426 10:86105524-86105546 GGCACACATCTAGATTGGGTGGG + Intronic
1077223132 11:1426141-1426163 GGCACCCAGCTGCATGGGACGGG + Intronic
1079273003 11:19006075-19006097 GGCACACTGATGCATGGGGTGGG - Intergenic
1080161260 11:29179594-29179616 GTCACTCATCTGTTTTGGGTTGG + Intergenic
1080178132 11:29392197-29392219 GGAACTCAGCTGTATGGGGTTGG - Intergenic
1080532415 11:33189963-33189985 GGCTGCCATCTGCATGGAGTTGG - Intergenic
1080854058 11:36096434-36096456 GGCACCCATATTCATGTGGTGGG - Intronic
1081831787 11:46121016-46121038 GGAACTCTTCTTCATGGGGAGGG + Intronic
1082965511 11:58962990-58963012 GGAGCTCATCTGCAAGGTGTGGG - Intronic
1082978762 11:59101595-59101617 GGGGCTCATCTGCAAGGCGTGGG - Intergenic
1083501811 11:63115801-63115823 GGCTGCCATCTGCATGGGGCTGG - Intronic
1086245472 11:84746821-84746843 GGCCTTCCTCTGCATGGGGATGG + Intronic
1086645916 11:89220080-89220102 GCCACTTATCTGCTTGTGGTAGG + Intronic
1088567187 11:111184469-111184491 GGCACACTGCTGCAAGGGGTGGG - Intergenic
1089480818 11:118803570-118803592 GGCAGTCATCTGCCTTGAGTAGG - Intergenic
1090217623 11:124983952-124983974 GGCACTCACAGGCATGGGGCTGG + Intronic
1090268686 11:125370864-125370886 GGCACTCATCTGAATGGAAAGGG - Intronic
1090330096 11:125924674-125924696 TGCTTTCATCTGCATGGGGAAGG - Intergenic
1090660465 11:128878515-128878537 GACCCACATCTGCAGGGGGTTGG + Intergenic
1090902939 11:131048329-131048351 GGCTCTAGCCTGCATGGGGTAGG - Intergenic
1093788202 12:23216437-23216459 GGCACACTGCTGCAAGGGGTGGG - Intergenic
1094471289 12:30804103-30804125 GGCACACTTGTGCAAGGGGTGGG + Intergenic
1098787899 12:74782381-74782403 TGCAATCAGCTGCAGGGGGTTGG + Intergenic
1099860783 12:88222877-88222899 GGCACACTGGTGCATGGGGTAGG - Intergenic
1100531673 12:95467314-95467336 GGCTACCATCTGCATGGGGCTGG - Intergenic
1101746543 12:107545915-107545937 CGGACTCATCTGCATGGAGGTGG - Intronic
1102767940 12:115449854-115449876 GCCCCTCATCTGCCAGGGGTTGG - Intergenic
1103164147 12:118755809-118755831 GGCACTCATATGCTTGAGGGTGG + Intergenic
1104355874 12:128086871-128086893 GGCACTCATCTCCAATAGGTAGG + Intergenic
1105898936 13:24740651-24740673 GGCACTCAAAGGCATGGGCTTGG + Intergenic
1107456407 13:40559769-40559791 GGCACTCATCTGCATGGGGTGGG + Exonic
1113556163 13:111237008-111237030 GCCAGTGATCTGTATGGGGTTGG + Intronic
1117199167 14:53370907-53370929 GGCACCCTTCTGCAGGGGCTTGG - Intergenic
1119082232 14:71705961-71705983 GGAAATCAACTGCATGGGGAGGG - Intronic
1119485216 14:74982400-74982422 GCTACTCCTCTGCATGGGGCTGG + Intergenic
1120159985 14:81135561-81135583 GGCTCACATCTGATTGGGGTGGG + Intronic
1121238709 14:92412484-92412506 GGCTCTGATCTGCATTTGGTGGG + Intronic
1122815389 14:104309628-104309650 GCCCCGCATCTGCATGGGGCCGG - Intergenic
1123887562 15:24742020-24742042 GGCACTCTTCAGCAGGGTGTGGG - Intergenic
1125430826 15:39591558-39591580 GACACTGATATGGATGGGGTTGG + Exonic
1134296917 16:12954439-12954461 GGGAATCATGTGCATGTGGTTGG + Intronic
1137958738 16:52859940-52859962 TGCATGCTTCTGCATGGGGTGGG - Intergenic
1138658387 16:58503570-58503592 TGAACTGATCTGCATGGGGAAGG - Intronic
1141641475 16:85344154-85344176 GGCACTAATGGACATGGGGTGGG + Intergenic
1142066270 16:88064778-88064800 GGCACTCCTCTGGCTGGGATAGG + Intronic
1143639479 17:8187941-8187963 GGCACTGATCTGCAGAGTGTGGG + Intergenic
1147886090 17:43685298-43685320 GGCTCTGATCTGCATGTGGCGGG - Intergenic
1148948546 17:51287648-51287670 GGCACTGATTTGGATGTGGTGGG + Intronic
1152008778 17:77698021-77698043 GGCACCCAGCTGCTTGGGCTGGG - Intergenic
1152033702 17:77858895-77858917 GGAGCTCATCTAGATGGGGTGGG + Intergenic
1154484489 18:14862818-14862840 GGCACACTTGTGCAAGGGGTGGG - Intergenic
1159960288 18:74550251-74550273 GGCACTTTGCTGCAAGGGGTGGG - Intronic
1161175694 19:2841233-2841255 GTCACTCACCGGCAGGGGGTGGG + Intergenic
1161425894 19:4202913-4202935 TGCACCCACCTGCATGGTGTAGG - Exonic
1164860575 19:31559096-31559118 GGTGCTCATAGGCATGGGGTTGG + Intergenic
1166476633 19:43131465-43131487 GTCACTCATGTGCATGGTTTGGG - Intronic
1167280968 19:48568347-48568369 GGCAGTAATGTGCACGGGGTGGG + Intronic
927524051 2:23721240-23721262 GGGACTTGTCTGCATGGGGTGGG - Intergenic
928345448 2:30489780-30489802 GGCTCTCTTCAGGATGGGGTGGG - Intronic
928353518 2:30585863-30585885 GGCAGTAATCTGCATGGTTTAGG - Intronic
928538078 2:32259050-32259072 GGAACTCATGTGGATGGGGTTGG + Intronic
929904739 2:46036084-46036106 GCCACTCATATGCCTGGGGGAGG + Intronic
934034617 2:88078545-88078567 TCCCCTCATCGGCATGGGGTTGG - Intronic
934536591 2:95139395-95139417 GGCACACTGCTGCAAGGGGTGGG - Intronic
936045381 2:109183925-109183947 GGCACTCACCTGCAACTGGTAGG - Intronic
936558266 2:113514607-113514629 GGGAATCATCAGCATGGGGGTGG + Intergenic
936721071 2:115253697-115253719 GGCACACTGCTGCAAGGGGTTGG + Intronic
936734707 2:115427111-115427133 GGCACACAGCTGCAAGGGGTGGG + Intronic
939352751 2:141061190-141061212 TGCACTAATCTGTCTGGGGTGGG - Intronic
940582658 2:155601137-155601159 GGCACTAATGAGCATGGGGAGGG - Intergenic
940973491 2:159919295-159919317 GACACCAATCTGCATGGTGTAGG + Intergenic
944471906 2:200062785-200062807 GGTAGTCATCTGCATGTGCTAGG + Intergenic
946446540 2:219744918-219744940 GGCATGCACCTGCATGGAGTTGG + Intergenic
947962650 2:234252664-234252686 AGCACCCATCTGGATGGGGAAGG + Intergenic
948402633 2:237694636-237694658 GGCTCTCCTCTGCATGGGTGCGG - Intronic
1168889714 20:1287052-1287074 GGAACACTTTTGCATGGGGTTGG - Intronic
1169075361 20:2756722-2756744 GGCACTGATCTGGAAGAGGTTGG + Intronic
1172837009 20:37879436-37879458 GAAACTCATCTGCATTAGGTGGG - Intergenic
1172930409 20:38582426-38582448 GGCACTCAGCAGCAGGAGGTAGG - Intronic
1173134246 20:40425222-40425244 GGCACTCATATACAGAGGGTTGG - Intergenic
1173134779 20:40429838-40429860 GGAACTCATTAGCATGGGGAGGG + Intergenic
1174338713 20:49882929-49882951 GGCTCACATCACCATGGGGTAGG - Intronic
1174602385 20:51735116-51735138 GGCTGCCGTCTGCATGGGGTTGG + Intronic
1175202733 20:57289352-57289374 GGGCATCCTCTGCATGGGGTGGG + Intergenic
1175535371 20:59707373-59707395 GGAACTCATCACCATGGGGAGGG - Intronic
1175746824 20:61462837-61462859 GACAGTCAGCAGCATGGGGTGGG + Intronic
1176723226 21:10410150-10410172 GGCACACTTGTGCAAGGGGTGGG - Intergenic
1176796839 21:13376647-13376669 GGCACACTTGTGCAAGGGGTGGG + Intergenic
1177594076 21:23212861-23212883 GGCACACTGCTGCAAGGGGTGGG + Intergenic
1177918512 21:27122540-27122562 GGCAGTCATTTGCATGGTGGTGG - Intergenic
1178403459 21:32306342-32306364 GGCAAGCAGATGCATGGGGTGGG + Intronic
1179362595 21:40726643-40726665 GGCACTGTTCCGCATAGGGTTGG - Intronic
1179769389 21:43603230-43603252 GGCACTGAGCTGCATGTGGAGGG - Intronic
1180304383 22:11062887-11062909 GGCACACTTGTGCAAGGGGTGGG - Intergenic
1182160000 22:28112033-28112055 GACACTCAGCTGAATGAGGTGGG - Intronic
1182549119 22:31091500-31091522 GGCACTCATCCCCATTGGGGAGG - Intronic
1183977717 22:41523018-41523040 GGCATTACTCAGCATGGGGTGGG - Intronic
1184901434 22:47448803-47448825 CGCACTCCTCTGCATGGTCTTGG - Intergenic
950442783 3:13019602-13019624 GGCTCTCAACAGAATGGGGTAGG + Intronic
952772623 3:37016440-37016462 GGCTACCATCTGCATGGGGCTGG - Intronic
954620666 3:51993669-51993691 GGCTACCATCTGCATGGGGCTGG - Exonic
960986896 3:123286676-123286698 TGCACTCACCTGGATGCGGTCGG + Exonic
961653132 3:128427291-128427313 GGTACACATGGGCATGGGGTGGG - Intergenic
962313065 3:134339494-134339516 GACACTCACCTGCAGGGGGTCGG - Intergenic
965298428 3:166978104-166978126 GGCACACTGCTGCAAGGGGTGGG - Intergenic
967933534 3:194708134-194708156 TGCAGTCATCTGCATGGGGCTGG + Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
969615054 4:8247381-8247403 GGGACTCATCCGCATGGGGAGGG + Intergenic
972284467 4:37635016-37635038 GGCCATCATCTGCATACGGTGGG - Exonic
976636037 4:87287193-87287215 GGCACTCTGATGCAAGGGGTTGG - Intergenic
984647298 4:182233305-182233327 GGCACTGTTCTGCATGGTGGCGG + Intronic
989648955 5:43666685-43666707 GGCTACCATCTGCATGGGGCTGG - Intronic
990451236 5:55933391-55933413 GGAAATCATGTGCATGGGCTAGG + Intergenic
992173776 5:74129408-74129430 GGCCATTATCTGCATGGAGTGGG - Intergenic
998535342 5:142925223-142925245 GTCACTCGTCTTCATGGGGGAGG - Intronic
999709105 5:154300713-154300735 CCCACTCTTCTGCAAGGGGTGGG + Intronic
1002180608 5:177429246-177429268 GGCACTCAGAGGCATGGGGAGGG + Intronic
1002697287 5:181099392-181099414 GGCACTCATCTGCATGGGGTGGG + Intergenic
1006212844 6:32411975-32411997 GGCACTCATCGGGCTGGAGTTGG + Intergenic
1007754321 6:44089169-44089191 GGCTGCCATCTGCATGGGGCTGG - Intergenic
1009618194 6:66038175-66038197 GGCACACTGCTGCAAGGGGTTGG + Intergenic
1012120876 6:95365594-95365616 GGCACACTGCTGCAAGGGGTGGG + Intergenic
1013191561 6:107808114-107808136 TGCACTCCTCTGCAGGGGATGGG + Intronic
1013233641 6:108177433-108177455 GGCCCTCATCAGCCTGGAGTGGG - Intronic
1014146105 6:117999506-117999528 GGCTATCATCTGCATGGGGCTGG + Intronic
1016287603 6:142490546-142490568 GTAACTCACATGCATGGGGTTGG + Intergenic
1016720918 6:147296161-147296183 GGCACTCATCTGCCAGGTGAGGG - Intronic
1018342735 6:162868597-162868619 GGATCTCACCTGCATGGGGCGGG - Intronic
1019347346 7:537602-537624 GGCACTCACCTTCATGGTGCTGG + Intergenic
1027586618 7:80066271-80066293 GGCACACTGCTGCAAGGGGTGGG + Intergenic
1028095690 7:86757603-86757625 GGCAGTGAGCTGCATGGAGTTGG - Intronic
1028160195 7:87476003-87476025 GACAGTCATCTGCAGGGGCTTGG - Intronic
1032463004 7:132125763-132125785 GGCACGGAGCTGCCTGGGGTAGG + Exonic
1033278756 7:139991289-139991311 GTCACGGACCTGCATGGGGTAGG - Intronic
1034880989 7:154762497-154762519 GGCACACAGCTGCCTGGAGTAGG - Intronic
1035309276 7:157954752-157954774 GACACTCAACTGCATGGGAGAGG - Intronic
1035407298 7:158607451-158607473 GGAACTCATCTGCAGGTGGAAGG - Intergenic
1037515710 8:19629498-19629520 GGCACTCAGCTGCCTGGTATTGG + Intronic
1042528949 8:69795510-69795532 GGCACTCTGATGCAAGGGGTGGG + Intronic
1043633249 8:82363482-82363504 AGAACACATATGCATGGGGTGGG - Intergenic
1044763678 8:95549083-95549105 GGCATTCATGTGCATGGGTAAGG - Intergenic
1045012130 8:97967637-97967659 GGCACACAGGTGCAAGGGGTGGG + Intronic
1045052477 8:98339744-98339766 GGCCCTCTTCTGCATGGGGAGGG + Intergenic
1045333081 8:101173239-101173261 GGCCCTCATCTGCATGGTCCAGG - Intergenic
1046636028 8:116676894-116676916 GCCAATCATCTGCATGGTGCTGG - Intronic
1047604001 8:126456175-126456197 GGCACTCATCCCCATTGGGATGG - Intergenic
1049115628 8:140684563-140684585 GGCACTCAACTGGATGTTGTTGG - Intronic
1049422820 8:142524428-142524450 GGCCCTCATCACCAGGGGGTGGG + Intronic
1049894596 9:101659-101681 GGGAATCATCAGCATGGGGGTGG - Intergenic
1051582679 9:18694663-18694685 GGCACTCAACTTCATAGGGGTGG - Intronic
1051869000 9:21715030-21715052 GGCACACTTCTGCAAGGGGTGGG + Intergenic
1054692573 9:68329749-68329771 GGGAATCATCAGCATGGGGGTGG + Intronic
1056454083 9:86743640-86743662 GGGAATCATCTGCATAGGGATGG - Intergenic
1060985441 9:127816701-127816723 GGGACTCTTCTGCCTGGTGTGGG + Intronic
1061432139 9:130537694-130537716 GACGCTCATCTGCACGGTGTGGG + Intergenic
1062174515 9:135153514-135153536 GCCACTTAACTCCATGGGGTGGG + Intergenic
1062465403 9:136678578-136678600 GGCACTAGTCTGCATGGAGAGGG - Intronic
1185501658 X:601308-601330 GACAATCACCTCCATGGGGTTGG - Intergenic
1187644182 X:21328630-21328652 GGCACTGGTGGGCATGGGGTGGG - Intergenic
1190425168 X:50329005-50329027 GGCACACTGCTGCAAGGGGTGGG + Intronic
1191640375 X:63424961-63424983 GGCACTTCTCAGCATGGAGTGGG - Intergenic
1191883219 X:65863061-65863083 GGCACTCATCAGGATGGGAGAGG - Intergenic
1192937039 X:75871008-75871030 GGCACACTTGTGCAAGGGGTGGG - Intergenic
1194572908 X:95574773-95574795 GGCACACAGCAGCAAGGGGTTGG - Intergenic
1194861268 X:99001471-99001493 AGCCCTAATCTGCATGGAGTAGG + Intergenic
1195486194 X:105409623-105409645 CCCACTCATCTTCATGTGGTTGG - Intronic
1198774155 X:140161912-140161934 GACACTGATCTGTAAGGGGTTGG - Intergenic
1199536159 X:148905607-148905629 GGCACACATCTGCATGCAGGCGG - Intronic
1199596576 X:149510742-149510764 TGCATTCATCTGAATGGAGTGGG + Intronic