ID: 1107456511

View in Genome Browser
Species Human (GRCh38)
Location 13:40560425-40560447
Sequence CCATCTTTGCGGCAGATGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107456503_1107456511 25 Left 1107456503 13:40560377-40560399 CCATGTTTTCGGGATTGCTTATC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1107456511 13:40560425-40560447 CCATCTTTGCGGCAGATGGCGGG 0: 1
1: 0
2: 1
3: 2
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107456511 Original CRISPR CCATCTTTGCGGCAGATGGC GGG Exonic
901075909 1:6554565-6554587 CCCTCTTTTCGGCAGCTGGGAGG - Intergenic
907316140 1:53574013-53574035 CTATCTTTGCAGGAGCTGGCTGG - Intronic
909983944 1:82137307-82137329 CCATCTTTGAAGCAGAGAGCAGG - Intergenic
918264848 1:182832260-182832282 CCATGTTTGAGGCAGATGTTGGG + Intergenic
922696385 1:227733119-227733141 CCCTCTTGGCTGCAGAGGGCTGG - Intronic
924939334 1:248801893-248801915 TCATCTTTCCGGCAGGTGGAAGG - Intergenic
1066242865 10:33554778-33554800 CCATCTATACTGCCGATGGCAGG + Intergenic
1068633418 10:59321918-59321940 CCTTCTTTGGGGCAGTGGGCTGG - Intronic
1071279812 10:84090749-84090771 CCATCTTTGAGGCAGAGATCTGG - Intergenic
1072579623 10:96729404-96729426 CCAGCTTTTCGTCAGAGGGCAGG - Intergenic
1073475204 10:103748046-103748068 CCATCCTTGCAGGAGATGGGTGG - Intronic
1075253171 10:120900598-120900620 CCATCCGTGCTGCACATGGCAGG - Intronic
1077109509 11:855906-855928 GCGGCTTTGTGGCAGATGGCTGG - Intronic
1079573763 11:21977473-21977495 CCATCTTGGCAGCAGTTGGGAGG + Intergenic
1081715305 11:45245955-45245977 CCACCTTTCAGGCAGATGTCAGG - Intronic
1089708097 11:120295321-120295343 CCATCTTGGAGGCAAGTGGCAGG - Intronic
1097953828 12:65462997-65463019 CCATCTTTGCGGCTATTGACAGG + Intronic
1102551436 12:113694939-113694961 CCATCTTGGTGGCAGCTGCCCGG + Intergenic
1103764129 12:123269833-123269855 CCATCTTGGATGCAAATGGCAGG + Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1107456511 13:40560425-40560447 CCATCTTTGCGGCAGATGGCGGG + Exonic
1107754582 13:43606480-43606502 CCATTTTTGTTGCAGATGACAGG - Intronic
1108162327 13:47653955-47653977 CCATGTTTGTTGCAAATGGCAGG + Intergenic
1109314708 13:60736351-60736373 TCATCTTGCCAGCAGATGGCTGG + Intergenic
1116347308 14:43811285-43811307 CCATATTTGCTGTAGTTGGCAGG + Intergenic
1117287681 14:54302691-54302713 CCATCTTGCAGGCACATGGCAGG - Intergenic
1118896800 14:69952199-69952221 CCATCTGTGCCTCTGATGGCAGG + Exonic
1122381869 14:101313600-101313622 CCAACTTGGGGGCAGATGGAGGG - Intergenic
1128728997 15:70007876-70007898 CCATCTTGGGCACAGATGGCAGG + Intergenic
1129170673 15:73805673-73805695 CCAGCTTTGAGGCACAAGGCTGG - Intergenic
1129850544 15:78791216-78791238 CCATCTCTTGGGCAGGTGGCTGG - Exonic
1130090601 15:80817700-80817722 TCATCTTTGCAGCAGTTGTCAGG - Intronic
1130509727 15:84579403-84579425 CCATCTTGCAGGCAGATGGGAGG - Intergenic
1130585442 15:85177352-85177374 CCATCTTGCAGGCAGATGGGAGG + Intergenic
1131171863 15:90184768-90184790 CCATCGTTGGTGCAAATGGCCGG + Intronic
1134883640 16:17770482-17770504 CCAGCTTTGCTGCTAATGGCTGG - Intergenic
1142482606 17:228090-228112 CCATCTTGGTGGCAGCTGGAGGG + Intronic
1143473703 17:7191593-7191615 CCATCTCTGGGGCTGAAGGCTGG - Intronic
1144683602 17:17211592-17211614 CCATCTGAGAGGAAGATGGCTGG - Intronic
1147673180 17:42188679-42188701 CCATCTTGGAGGCTGATGGGAGG - Intergenic
1148689658 17:49520010-49520032 CCAGCTCTGCGGCAGCTGGTGGG + Intergenic
1153533041 18:6069092-6069114 CCATCTTTGATGGAGATGGCAGG + Intronic
1153844259 18:9034128-9034150 CCATCTTGGAGGCAGACAGCAGG + Intergenic
1159546677 18:69847945-69847967 CCATCTTTACTGCAGATGACAGG + Exonic
1166395424 19:42436238-42436260 CCATCTGTGTGGCAGAAGTCTGG - Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
945036672 2:205709450-205709472 CCACCTTTGCGGGTGGTGGCAGG - Intronic
946388644 2:219401975-219401997 CTATCTTTCTGGAAGATGGCAGG - Intergenic
1175897802 20:62347059-62347081 CCATCCTGGAGGCAGGTGGCAGG + Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181850706 22:25748035-25748057 CCACTTCTGCGGCAGAAGGCAGG + Intronic
1185067781 22:48640648-48640670 CCATCTGTGCGCCATGTGGCTGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
958725571 3:97901777-97901799 CCTTGTTTGGGGCAGATTGCTGG + Intronic
960950869 3:122997666-122997688 GCATCTTTGCTGCAGAGGGAGGG - Intronic
966849336 3:184155268-184155290 CCGGCGTCGCGGCAGATGGCAGG - Intronic
968630118 4:1646023-1646045 CCATCTTGGAAGCAGAGGGCAGG + Intronic
969752952 4:9126047-9126069 CAATCTTTGGGGATGATGGCTGG - Intergenic
975766769 4:77676821-77676843 CGATTTTTGTTGCAGATGGCGGG - Intergenic
979659455 4:123237293-123237315 GCACCTTTGAGGCACATGGCAGG - Intronic
981737543 4:147968720-147968742 CCATCTTAGAGGCAGAAGTCAGG - Intronic
986581315 5:9269243-9269265 ACACCTTGGCGCCAGATGGCAGG + Intronic
1000730213 5:164825858-164825880 CTATCTTTGCGGGAGCGGGCAGG - Intergenic
1002131153 5:177082420-177082442 CCATCTTTGCCCCAGAAGACAGG + Intergenic
1002697385 5:181100034-181100056 GCATCTTTGCCGCAGATGGCGGG + Intergenic
1004519646 6:16349581-16349603 CCATCTTTGCTGGAGCTGACTGG - Intronic
1022385759 7:29897754-29897776 CCATCTTTGCGGAAGGCAGCTGG + Intronic
1024497939 7:50069561-50069583 CCCTCTTTGTGTTAGATGGCTGG - Intronic
1026403180 7:70037078-70037100 CCCACGTTGTGGCAGATGGCAGG - Intronic
1027730181 7:81861214-81861236 CCATGTTTGCTGCATATGACAGG - Intergenic
1031857534 7:126940444-126940466 CCATCTTGGCCGCATATGGTGGG + Intronic
1034443841 7:151101710-151101732 CCTCCTCTGCGGCAGATGCCAGG - Intronic
1038620709 8:29140184-29140206 CCCTCATTGCTGCAGGTGGCAGG - Exonic
1049379789 8:142306255-142306277 CCATGTTTGAGGCACAGGGCTGG - Intronic
1050395322 9:5188973-5188995 CCATCACTGCCCCAGATGGCTGG + Intergenic
1058776999 9:108294050-108294072 CCATCTTTGTGGGACATTGCAGG - Intergenic
1062145310 9:134985976-134985998 CCCTCTTTGAGGCTGATGTCTGG + Intergenic
1186609717 X:11127328-11127350 CCATGGTTGTGGTAGATGGCCGG - Intergenic
1189701620 X:43719408-43719430 CCACCCTTGTGGCAGATTGCTGG - Intronic
1190034220 X:47005610-47005632 CCATCTTTGCTGGAGAAGGTTGG - Intronic
1193299947 X:79878179-79878201 CCATCTTTGAAGCAGAGAGCAGG + Intergenic
1199406559 X:147468669-147468691 CCATCTGTGATGCAGATGGAAGG + Intergenic
1200073359 X:153539593-153539615 CCGTCCCTGCAGCAGATGGCAGG + Intronic
1200367195 X:155679394-155679416 CCATCTTTGAAGCAGAGAGCAGG - Intergenic
1201522885 Y:14896176-14896198 CCTTCTTGGCTGCAGTTGGCAGG + Intergenic