ID: 1107456530

View in Genome Browser
Species Human (GRCh38)
Location 13:40560592-40560614
Sequence TCCAAATGGCCTGCAAGCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107456530_1107456532 -8 Left 1107456530 13:40560592-40560614 CCAGGGCTTGCAGGCCATTTGGA 0: 1
1: 1
2: 1
3: 18
4: 191
Right 1107456532 13:40560607-40560629 CATTTGGAAAACTGTGATCCAGG 0: 1
1: 1
2: 3
3: 27
4: 249
1107456530_1107456533 -7 Left 1107456530 13:40560592-40560614 CCAGGGCTTGCAGGCCATTTGGA 0: 1
1: 1
2: 1
3: 18
4: 191
Right 1107456533 13:40560608-40560630 ATTTGGAAAACTGTGATCCAGGG 0: 1
1: 0
2: 2
3: 28
4: 296
1107456530_1107456539 23 Left 1107456530 13:40560592-40560614 CCAGGGCTTGCAGGCCATTTGGA 0: 1
1: 1
2: 1
3: 18
4: 191
Right 1107456539 13:40560638-40560660 CAGCACCCTCCTGGCCAGACTGG 0: 1
1: 0
2: 2
3: 26
4: 318
1107456530_1107456535 14 Left 1107456530 13:40560592-40560614 CCAGGGCTTGCAGGCCATTTGGA 0: 1
1: 1
2: 1
3: 18
4: 191
Right 1107456535 13:40560629-40560651 GGCTGTCCCCAGCACCCTCCTGG 0: 1
1: 0
2: 8
3: 104
4: 541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107456530 Original CRISPR TCCAAATGGCCTGCAAGCCC TGG (reversed) Exonic
901175364 1:7294836-7294858 ACCAAATGGCCTCCAAGGCAAGG + Intronic
902726949 1:18343216-18343238 TCCAAATGGCCAAGAAGCACAGG - Intronic
903812928 1:26045135-26045157 GCTCAATGGCCTGCAAGTCCAGG + Exonic
904270909 1:29349484-29349506 TCCATGTGGCCCCCAAGCCCAGG - Intergenic
904378675 1:30097008-30097030 TCAAAAGGGCCTGGAAGGCCAGG + Intergenic
905150258 1:35921543-35921565 TCCAGCTGGCCTCCAAGCCTGGG - Exonic
906057560 1:42928831-42928853 ACCAAAAGGCCTGCCAGCCTGGG + Intronic
906975327 1:50564258-50564280 TCCAAATGGCTTACAGGTCCAGG + Intronic
907395461 1:54186644-54186666 TCCAAATGGCCTGCTTCCCCAGG - Intronic
909762501 1:79309375-79309397 ACCAAATGGCCTGCATGTCTTGG + Intergenic
911278410 1:95893117-95893139 TTAAAATGGCCTCCAAGCCTGGG - Intergenic
911733786 1:101315701-101315723 TCTAAATGGCTGGCAATCCCTGG - Intergenic
914677529 1:149916307-149916329 TCCTCAGGGCCAGCAAGCCCAGG + Intronic
916606053 1:166343296-166343318 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
921356922 1:214293592-214293614 TCCAAATGGCCCACACGACCTGG - Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1063466133 10:6246065-6246087 TCCCCATGGCCTGGATGCCCTGG + Intergenic
1067145607 10:43691631-43691653 TCCAGATGGATGGCAAGCCCAGG - Intergenic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1068832497 10:61512669-61512691 TGTAAATGACCAGCAAGCCCAGG - Intergenic
1070552005 10:77497259-77497281 TGCAAATGGCCTTCATGCCCAGG - Intronic
1073270845 10:102262577-102262599 ACCAAAAGGCCTACAAGGCCAGG - Intronic
1074360006 10:112818082-112818104 AGCAAATGGCCTCCCAGCCCAGG - Exonic
1074879764 10:117646881-117646903 TCCACCTGGCCTGGGAGCCCGGG + Intergenic
1075717757 10:124566788-124566810 CCCAAATGGCCCTCCAGCCCTGG - Intronic
1076135364 10:128041882-128041904 GACAAATGTCCTGCAAACCCTGG + Intronic
1077525334 11:3060792-3060814 GTCACATGGCCTGCAAGCCAGGG + Intergenic
1079004942 11:16784888-16784910 TCCTGATTGCCTGCCAGCCCAGG - Intronic
1079393558 11:20042853-20042875 TCCAACTGGCCTCAAACCCCAGG + Intronic
1081490495 11:43564596-43564618 TCCAATTTGCTTCCAAGCCCTGG - Intronic
1084637644 11:70403077-70403099 TACAAATGGCCAACAAGCTCAGG - Intronic
1084891933 11:72240926-72240948 TCCCAAGGGCCTCCAAGTCCGGG + Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1086531260 11:87788221-87788243 TTTACATGGCCTGCAAGGCCTGG - Intergenic
1088215774 11:107507298-107507320 TCAAAATGGCCAAAAAGCCCAGG + Intronic
1088462342 11:110093917-110093939 TCCAGATCGCCAGCAACCCCAGG + Intronic
1088692814 11:112342312-112342334 TCAAAATGACCTGGAAGGCCAGG - Intergenic
1088708001 11:112481020-112481042 TCCGCATGACCTGCAAGACCAGG - Intergenic
1090275080 11:125413372-125413394 TCCAAATTGCCTGAGAGCCAGGG + Intronic
1092566309 12:9669774-9669796 TCTGAATTGCCTGCAAACCCAGG + Exonic
1093152748 12:15642798-15642820 TACAACTGTCCTGCAGGCCCTGG - Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1097069002 12:56341140-56341162 TCCAAAGGGACTCCAAGGCCGGG - Intergenic
1097340729 12:58434939-58434961 TACAAATGGCCAACAAGCACAGG - Intergenic
1097690922 12:62733923-62733945 TCCCACTGGCCTGCAAACCAGGG - Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1098692858 12:73511135-73511157 TACAAATTGCCTGCAAGGCTGGG - Intergenic
1099380896 12:81951047-81951069 TCCACATGACCAGCAAGCACCGG - Intergenic
1101516856 12:105444278-105444300 GCGTAATGGCCTGCCAGCCCTGG - Intergenic
1101559337 12:105841098-105841120 TCCACATGGCTTCTAAGCCCCGG + Intergenic
1104703421 12:130924575-130924597 TCCAAATGGCCAATAAGCACAGG - Intergenic
1105467602 13:20660648-20660670 TCTAAATGGCCAGCAAGTGCTGG - Intronic
1107456530 13:40560592-40560614 TCCAAATGGCCTGCAAGCCCTGG - Exonic
1113677386 13:112216014-112216036 TCCGAAGGGCCTGCAGGCCCTGG - Intergenic
1113710982 13:112465394-112465416 AGCAAACGGCCAGCAAGCCCAGG + Intergenic
1113750370 13:112772826-112772848 TGCAAATGGCCAACAAGCCCAGG - Intronic
1114619803 14:24088550-24088572 TCACAATGGCCTGGAAGGCCAGG - Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1120465490 14:84851732-84851754 TTTAAATGGCCTGAAAGCTCAGG - Intergenic
1120966658 14:90173670-90173692 TCCCAATGGCTTGCAAGCAAGGG + Intronic
1122144693 14:99682778-99682800 TCCAAATTGCCCTCAAGCCCCGG + Intergenic
1123578671 15:21696849-21696871 ACCAAATGGACAGCAAGCTCAGG + Intergenic
1123615298 15:22139331-22139353 ACCAAATGGACAGCAAGCTCAGG + Intergenic
1125453213 15:39830517-39830539 TGCAACTTGCCTGCATGCCCAGG - Intronic
1129709748 15:77814727-77814749 TCCATCTGGCATCCAAGCCCAGG + Intronic
1130537542 15:84798058-84798080 TCCACAGGGCCTGCTGGCCCTGG - Intronic
1131563690 15:93466193-93466215 CCCAGGTGGCCTGTAAGCCCAGG + Intergenic
1202987541 15_KI270727v1_random:431094-431116 ACCAAATGGACAGCAAGCTCAGG + Intergenic
1135342977 16:21664406-21664428 TCCAAGTGCCCTCCAATCCCAGG - Intergenic
1136783618 16:32922247-32922269 TCCCAGCAGCCTGCAAGCCCTGG - Intergenic
1139004156 16:62550856-62550878 TCCAAATGTCTAGCAAGTCCTGG + Intergenic
1140232224 16:73126752-73126774 TCACAATGTCCTGCAATCCCTGG - Exonic
1144848880 17:18234109-18234131 TCCAGATGACCAGCAGGCCCCGG - Exonic
1145200570 17:20941273-20941295 TCAGAATGGGCTGCAAGCACAGG - Intergenic
1146964462 17:37013191-37013213 TACAAATGGCCAGTAAGCACAGG + Intronic
1148463167 17:47849806-47849828 TCCCTAAGGCCTGGAAGCCCTGG + Intronic
1150506163 17:65701086-65701108 TCCTAATGGCCTCCCAGCCATGG - Intronic
1150875801 17:68968883-68968905 TCCAAAAGGACTGTAATCCCAGG + Intergenic
1151962971 17:77416920-77416942 GCCAAATGGCCAGACAGCCCTGG - Intronic
1152563612 17:81090625-81090647 CCCCAGTGGCCTGGAAGCCCAGG + Intronic
1157663262 18:49464266-49464288 GCCAAATATCCTTCAAGCCCTGG + Intergenic
1165155939 19:33787625-33787647 TCATAATGACCTGGAAGCCCGGG - Intergenic
1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG + Exonic
1166982107 19:46637085-46637107 TTTAAATGGCATGCAAGGCCAGG - Intergenic
926729489 2:16025495-16025517 CCAAAAAGTCCTGCAAGCCCAGG - Intergenic
928238361 2:29564913-29564935 TATAACTGGCCTGCAAGCCTGGG - Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929694035 2:44099025-44099047 TCAAAATAGCCTTCAAGCTCTGG + Intergenic
931771156 2:65499293-65499315 TCCCCTTGGCCTTCAAGCCCAGG - Intergenic
932866672 2:75350558-75350580 ACCAACTGGCCTGCTAGGCCTGG - Intergenic
933506315 2:83181140-83181162 GCCAGCCGGCCTGCAAGCCCCGG + Intergenic
933658469 2:84907423-84907445 TCTGAATGGCCTGCAGCCCCAGG - Intergenic
934040500 2:88124237-88124259 TCCACCTGCCCTGCATGCCCAGG - Intronic
935362352 2:102257490-102257512 TGCTAATGGCCAGCAAGACCAGG - Intergenic
936580651 2:113697655-113697677 TACAAATGGCCAGCAAGTCCAGG + Intergenic
937091892 2:119212093-119212115 TCCAAAAGGCAGACAAGCCCTGG + Intergenic
940102152 2:150053699-150053721 TCCAAATGGTTTGGTAGCCCAGG - Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG + Intergenic
944590872 2:201216893-201216915 GCTATATGTCCTGCAAGCCCAGG + Intronic
946613390 2:221482947-221482969 AGCAAATGGGCTCCAAGCCCAGG + Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948689581 2:239693583-239693605 TGCAGATGGCCAACAAGCCCGGG - Intergenic
948832709 2:240606035-240606057 ACCAGATGGCCTGCAAGCTATGG - Intronic
1170439953 20:16368998-16369020 TCAAAATGGCCAGCATGCTCAGG + Intronic
1170609913 20:17904147-17904169 TGCAAATGGCCAGCACGCACAGG + Intergenic
1170733137 20:18991080-18991102 TCCCTATGGCATACAAGCCCTGG + Intergenic
1170843509 20:19943076-19943098 TCCCGATGCCCTTCAAGCCCGGG - Intronic
1171334452 20:24370877-24370899 TGAACATGGCCTGCAAGCCTGGG - Intergenic
1173860237 20:46278253-46278275 GCTGAAGGGCCTGCAAGCCCAGG - Intronic
1174842352 20:53912147-53912169 GCCAACTGGCCTGCAGGCCCAGG - Intergenic
1175771046 20:61624536-61624558 ACCAAATGGCCTCCAAGGCCAGG + Intronic
1176359849 21:5985745-5985767 TCCAAATGGCCAGTAAACACAGG - Intergenic
1176423281 21:6532958-6532980 CCCAAATGCCCTGCAAGCCAAGG - Intergenic
1178441300 21:32600619-32600641 TCCAAGTATCCTGCAAACCCTGG - Intronic
1179479266 21:41667265-41667287 TCCAAATGCCCTGGAAACCAAGG - Intergenic
1179698774 21:43141274-43141296 CCCAAATGCCCTGCAAGCCAAGG - Intergenic
1179763669 21:43552805-43552827 TCCAAATGGCCAGTAAACACAGG + Intronic
1183344932 22:37302213-37302235 TCTAAATGTCCTGCAAGGGCAGG + Intronic
1183474557 22:38028889-38028911 TCCAAAGGCCCTGCAAGCCCCGG + Intronic
1183936038 22:41262949-41262971 TCCAAAGGACCTGCAGGCCTTGG + Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950073157 3:10168615-10168637 TGCAAATGGCCAACAAGCACAGG - Intronic
951557584 3:23936356-23936378 TCACATTGGCCTGTAAGCCCTGG + Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953225145 3:41011802-41011824 TGCAACTGGCATGTAAGCCCTGG - Intergenic
955036403 3:55272449-55272471 TCCAACTGGTCTGCTAGTCCAGG + Intergenic
955978589 3:64501645-64501667 TCTAAATGGCCTGCGTGTCCTGG - Intergenic
956781326 3:72605625-72605647 TCCTAATGCCCTGCAACACCAGG - Intergenic
959192174 3:103128491-103128513 TCTACATGTCTTGCAAGCCCAGG + Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
964037510 3:152217334-152217356 TCCAGTTGGCCTGCAAGTGCAGG - Intergenic
964375043 3:156041416-156041438 GCCAGCCGGCCTGCAAGCCCCGG + Intronic
969125652 4:4945932-4945954 TCCAAATGCCATGGGAGCCCAGG - Intergenic
972783581 4:42306935-42306957 TCCAAATGACCCACAAGCCCTGG + Intergenic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
976825203 4:89253129-89253151 TCCAAAAACACTGCAAGCCCCGG + Intronic
977657269 4:99536547-99536569 TCCAGATGGCCTGCACTCCCTGG + Intronic
980259996 4:130436250-130436272 TACAGATGGCCTCAAAGCCCTGG + Intergenic
980864614 4:138540516-138540538 ACCAAATGTCCTGCAAGTACAGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
982622688 4:157727307-157727329 TCCACAAGGCCTGCAATCCTGGG + Intergenic
983560387 4:169095594-169095616 CCCAACTGACCTGCATGCCCAGG - Exonic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
992742919 5:79791870-79791892 TGCAATTTGCCTGCAAGCTCTGG + Intronic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995260994 5:110104274-110104296 CCCAACTGGCCTGCACACCCGGG - Intergenic
998965230 5:147532443-147532465 TCATAATCTCCTGCAAGCCCAGG + Intergenic
999110488 5:149116158-149116180 TCTAAATGGCCTGTGAGGCCAGG - Intergenic
1000881988 5:166708847-166708869 TCCAATTAGAATGCAAGCCCCGG + Intergenic
1001682804 5:173571006-173571028 TACAAAAGGCCTGCACGCCCTGG - Intergenic
1001999547 5:176189988-176190010 GGCAACTGGCCAGCAAGCCCAGG + Intergenic
1002649620 5:180681918-180681940 GGCAACTGGCCAGCAAGCCCAGG - Intergenic
1002697407 5:181100201-181100223 TCCAGATGGCCTGCAAGCCCTGG - Intergenic
1002890986 6:1331609-1331631 CCTACAAGGCCTGCAAGCCCAGG - Intergenic
1002971459 6:2026193-2026215 GCCACATGGCCAGAAAGCCCAGG - Intronic
1004800883 6:19145984-19146006 TTCAGATGTCCTCCAAGCCCTGG + Intergenic
1006211765 6:32401430-32401452 TTCAAAGGGCCTCCAGGCCCCGG + Intronic
1006267388 6:32936607-32936629 GCCAAATGGTCTGCCAGCCGTGG + Intronic
1006442903 6:34063170-34063192 TCCAAATGACCTGGAGGTCCAGG + Intronic
1008043008 6:46821845-46821867 TCTAAATTGCCTGCAACCACGGG + Intronic
1009901434 6:69812124-69812146 TCCAGATGGCTTGCAAGCAAGGG + Intergenic
1012529002 6:100211851-100211873 TCCAAAGGGCCTTAGAGCCCTGG - Intergenic
1013748686 6:113375896-113375918 TCCAAACCCCCTGCCAGCCCAGG + Intergenic
1014236923 6:118968351-118968373 TGCATATGGCCTGCAGGCCGTGG + Intronic
1018834573 6:167473322-167473344 TCCAAATTCCTTGCAGGCCCAGG - Intergenic
1019004162 6:168782450-168782472 TCCCCATGGCCAGCATGCCCAGG - Intergenic
1019589777 7:1825216-1825238 TCCACCTGGCCTGCAACCCTCGG + Intronic
1021712508 7:23429871-23429893 TCCAAATTACCTGTAAGTCCTGG + Intronic
1022244661 7:28546980-28547002 TCATAATGGCCTGGAAGGCCAGG - Intronic
1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG + Intergenic
1023402140 7:39798098-39798120 TCCACCTGCCCTGAAAGCCCAGG - Intergenic
1024115109 7:46185364-46185386 TCCAAATGTCCTGGAAGCATGGG - Intergenic
1024374257 7:48619689-48619711 GCCAAGTGGCCTCCAAACCCAGG + Intronic
1024888831 7:54178537-54178559 TACCAATGGCCTCCAATCCCTGG - Intergenic
1026279868 7:68912636-68912658 TCCAAATGTCATTCCAGCCCGGG - Intergenic
1026380812 7:69797585-69797607 TCCCAGTGGCCTCCAAGCGCAGG - Intronic
1028506599 7:91578552-91578574 TCCTAATGGCCTGAAAAGCCAGG + Intergenic
1029201713 7:98843559-98843581 GACAAATGGCCCGGAAGCCCTGG - Intergenic
1029340201 7:99936473-99936495 TGGAATTGGCCTGCATGCCCAGG - Intergenic
1031728912 7:125273048-125273070 TACAAATGGCCAGCAAGCACAGG - Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1037765415 8:21769471-21769493 TCCAGCTGCCCTGCAAGCACTGG - Intronic
1037814836 8:22106696-22106718 TCCAGTTGGCCTGCTGGCCCGGG - Intergenic
1038003635 8:23411633-23411655 CCCAAATGGGCTCCAAGCACAGG - Intronic
1038175458 8:25178288-25178310 GCCATATGGCCTGCAAAGCCTGG + Intergenic
1038250568 8:25900077-25900099 TCCAGGTTGCATGCAAGCCCAGG - Intronic
1038743198 8:30233587-30233609 TTCCAATGGACTACAAGCCCTGG + Intergenic
1038949889 8:32402652-32402674 TCCTAATGGCCTCAAAGCACAGG + Intronic
1040691147 8:49940170-49940192 ACCAAATGCCCTGAAAGACCTGG + Intronic
1041489290 8:58413710-58413732 CCCAAAAGGCCTCCCAGCCCTGG + Intronic
1042607375 8:70558861-70558883 TCCAAGTGGGCTGGAAGGCCTGG - Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1047224182 8:122942780-122942802 TACAAGTGGCCTGCAGCCCCTGG - Intronic
1049288078 8:141787327-141787349 CCTGAAGGGCCTGCAAGCCCAGG + Intergenic
1050339840 9:4625440-4625462 GCCCAAAGGCATGCAAGCCCGGG - Exonic
1056146375 9:83734213-83734235 TCTAAATGGCCTGCAATCCTAGG - Intergenic
1056852482 9:90096224-90096246 TGCAGATGCCCTCCAAGCCCTGG + Intergenic
1060348615 9:122838200-122838222 AGTAAAAGGCCTGCAAGCCCAGG + Intergenic
1061844541 9:133379663-133379685 TCCCCATGCCCTGCTAGCCCTGG - Intronic
1061901615 9:133675402-133675424 TGCAAATGGCCAACAGGCCCAGG + Intronic
1062572822 9:137193480-137193502 TCCCAGTGGCCTTGAAGCCCAGG + Intronic
1062742262 9:138182732-138182754 TGCAAATGACCAGCAAGCACAGG - Intergenic
1187474169 X:19595491-19595513 AACAAATGGCCTGCCAGCCTCGG - Intronic
1190366559 X:49700239-49700261 TACAAATGGTCAGCAAGCACAGG - Intergenic
1192437387 X:71151431-71151453 TCCAAATGGCCACCAGGTCCTGG - Intronic
1194025600 X:88746590-88746612 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
1195386021 X:104314193-104314215 CCCAAATGGCCTGCCTGCCTTGG + Intergenic
1197772851 X:130100458-130100480 ACCAACTGGGCTTCAAGCCCAGG - Intronic
1200039077 X:153353079-153353101 TCCAAGTGCCCAGCAAGCACTGG - Intronic
1200071530 X:153531661-153531683 TCCAGATGGTCTGAATGCCCAGG + Intronic