ID: 1107456729

View in Genome Browser
Species Human (GRCh38)
Location 13:40562437-40562459
Sequence CTTAAGACACATTAGGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107456729_1107456738 23 Left 1107456729 13:40562437-40562459 CCTAGCCCCTAATGTGTCTTAAG 0: 1
1: 0
2: 3
3: 19
4: 161
Right 1107456738 13:40562483-40562505 TAAATTACAGAGCCTTATCAGGG 0: 1
1: 0
2: 0
3: 14
4: 196
1107456729_1107456734 -1 Left 1107456729 13:40562437-40562459 CCTAGCCCCTAATGTGTCTTAAG 0: 1
1: 0
2: 3
3: 19
4: 161
Right 1107456734 13:40562459-40562481 GTTTCCTCACCTGTAAAGCAGGG 0: 1
1: 21
2: 227
3: 1162
4: 3945
1107456729_1107456737 22 Left 1107456729 13:40562437-40562459 CCTAGCCCCTAATGTGTCTTAAG 0: 1
1: 0
2: 3
3: 19
4: 161
Right 1107456737 13:40562482-40562504 CTAAATTACAGAGCCTTATCAGG 0: 1
1: 0
2: 1
3: 7
4: 106
1107456729_1107456733 -2 Left 1107456729 13:40562437-40562459 CCTAGCCCCTAATGTGTCTTAAG 0: 1
1: 0
2: 3
3: 19
4: 161
Right 1107456733 13:40562458-40562480 AGTTTCCTCACCTGTAAAGCAGG 0: 1
1: 40
2: 482
3: 2724
4: 7867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107456729 Original CRISPR CTTAAGACACATTAGGGGCT AGG (reversed) Intronic
901862327 1:12082222-12082244 CTTGAAACACATGGGGGGCTTGG + Intronic
902239206 1:15077198-15077220 CCTGAGACAAATTAGGGCCTTGG - Intronic
903940585 1:26927689-26927711 GTTAAGAAAAATTAGGGGCTGGG - Intronic
904530684 1:31166808-31166830 CTTAAAACACAGTTAGGGCTGGG + Intergenic
905122758 1:35694529-35694551 CTTAAAACACATTGTTGGCTGGG + Intergenic
905500759 1:38434427-38434449 CTTAAGACAAATCAGGGGAGTGG + Intergenic
905774014 1:40656486-40656508 TTAAAGACACATTAGAGGCCGGG + Intronic
906174354 1:43757198-43757220 TTTAAAACACATTGGGGGCCAGG - Intronic
909015961 1:70379880-70379902 CTTAAGACATAATTGGGGCCGGG - Intronic
909486852 1:76184241-76184263 GTTAAGAAACATATGGGGCTGGG + Intronic
910247521 1:85156249-85156271 CCTAAAAAACATTAGGGGCTGGG + Intergenic
912222813 1:107697699-107697721 CTTAAGACACATTCAGTTCTAGG - Intronic
912709225 1:111937807-111937829 CTGAACACACATTCTGGGCTGGG + Intronic
912949318 1:114109935-114109957 CTAAAGACACAGAAGGGGCAGGG + Intronic
915978125 1:160403786-160403808 CTTAAGACACCTAAGAGGCTGGG - Intronic
916891526 1:169116553-169116575 CTTAAAACTCATTAGGGGCCTGG + Intronic
917563189 1:176181545-176181567 CTTAAAACACATTCTTGGCTGGG + Intronic
919854067 1:201693910-201693932 TTTTAGACACCTTGGGGGCTGGG + Intronic
923229509 1:231971616-231971638 CTGCAGACACTTTAGGTGCTGGG + Intronic
1063378960 10:5572288-5572310 CTTATGCACCATTAGGGGCTTGG + Intergenic
1070643251 10:78184024-78184046 GTAAAGTCACATTAGGGGTTAGG - Intergenic
1071541603 10:86489922-86489944 CTTAAGACACAGTTTTGGCTTGG + Intronic
1072310508 10:94149828-94149850 CTTCAGAGACAGCAGGGGCTGGG + Intronic
1073226263 10:101922549-101922571 CTTAAGAAATAGAAGGGGCTGGG - Intronic
1074026287 10:109639331-109639353 CTTAAGACACAATATAGGCTTGG + Intergenic
1075152046 10:119942569-119942591 ATTAAACCAGATTAGGGGCTGGG - Exonic
1075838361 10:125475471-125475493 CTTAAGACGCATTAGCCACTGGG + Intergenic
1079362137 11:19777889-19777911 ATCAAGACACAATGGGGGCTCGG - Intronic
1082019928 11:47523754-47523776 CTTATGACTCATGAGGGGATGGG + Exonic
1084449097 11:69222292-69222314 CTTTAAAAACATTTGGGGCTGGG + Intergenic
1084720724 11:70904012-70904034 TTTAATACAGATTAGGGGTTTGG - Intronic
1085292756 11:75411683-75411705 CTTAAGACATATTAAGGGCTGGG - Intronic
1089843805 11:121442337-121442359 ATTAAGACTCAATTGGGGCTGGG + Intergenic
1090064423 11:123491035-123491057 CTTAAAAGACATTTGTGGCTGGG + Intergenic
1090667759 11:128926111-128926133 CTTGGGACACAGAAGGGGCTTGG - Intergenic
1090806990 11:130208990-130209012 CTTAAGGCACGTGAGGGGGTGGG + Intronic
1090851948 11:130578626-130578648 CTTAAGAAATATTAGGGGAAGGG - Intergenic
1092970830 12:13693061-13693083 CTTAAGAAAGATTAGAGGCTGGG - Intronic
1095253283 12:40003591-40003613 GTTAAGGCATATTAGGGGCCTGG - Intronic
1098289102 12:68938251-68938273 CTTAAAACACATTTAGGGATGGG + Intronic
1099652331 12:85443860-85443882 CTTAAGGCACATCAGGGGAATGG + Intergenic
1099934525 12:89109515-89109537 CTTATGACAAATTATGGGGTGGG + Intergenic
1100186932 12:92148740-92148762 CTGAAGGCACATTAGGGCCAGGG + Intergenic
1102721364 12:115019183-115019205 CTTAAGAGAACTTACGGGCTGGG + Intergenic
1103070311 12:117935836-117935858 CCTCAGACACCTCAGGGGCTTGG + Intronic
1103105836 12:118223933-118223955 CATAAGAAACCTTATGGGCTGGG - Intronic
1107456729 13:40562437-40562459 CTTAAGACACATTAGGGGCTAGG - Intronic
1107690943 13:42952415-42952437 GTTGAGAGAGATTAGGGGCTGGG - Intronic
1108752820 13:53465487-53465509 CTTAAAACACAGTTCGGGCTGGG - Intergenic
1110014332 13:70381176-70381198 ATTAACACAAATTAAGGGCTTGG - Intergenic
1110259029 13:73464546-73464568 CTTAAAAAAAATTAGGGGCCAGG - Intergenic
1113358756 13:109609132-109609154 CTGAAGACACGTGAGGGCCTGGG + Intergenic
1114264055 14:21060954-21060976 CTCAATACACATTACGGCCTTGG + Intronic
1115738768 14:36364658-36364680 CTTAAGACTCACATGGGGCTGGG - Intergenic
1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG + Intergenic
1117694097 14:58340778-58340800 CTTAAGACACAGGTGGGGCCGGG - Intronic
1118372270 14:65147447-65147469 TTTAAGATAGATTAGGGGCTGGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119645653 14:76346538-76346560 CTCAAGACACCATGGGGGCTTGG + Intronic
1120499078 14:85271549-85271571 ATAAAGACACATTTGGGACTTGG + Intergenic
1123767789 15:23499070-23499092 CTTAAGAGAGATTAAGGTCTGGG + Intergenic
1124570489 15:30858501-30858523 CTTAAGAGAGATTAAGGTCTGGG - Intergenic
1128167813 15:65482799-65482821 CTTAAAACACAATAGGGGCCGGG + Intronic
1129011072 15:72417852-72417874 CTAAAGGCACATGATGGGCTGGG - Intergenic
1129640905 15:77377087-77377109 CTAAACACAGATAAGGGGCTGGG + Intronic
1129654381 15:77514086-77514108 ATACAGACACATTAGGGGTTAGG + Intergenic
1133030173 16:3007021-3007043 TTTAAGACACATTACGTTCTGGG - Intergenic
1133644326 16:7749152-7749174 CTTTAGACACATTTGTAGCTAGG + Intergenic
1135928499 16:26716291-26716313 CTTAAGACACATTATTGACTGGG - Intergenic
1136369044 16:29824467-29824489 TTTAAGACTCACTAGGGGCCAGG + Intronic
1141600294 16:85121825-85121847 TTTAAAACAATTTAGGGGCTGGG + Intergenic
1143027299 17:3948471-3948493 CTTAAGACAGAAGAGAGGCTGGG - Intronic
1143622698 17:8089966-8089988 CTGAACACACAGTAGGGGTTCGG - Intergenic
1145776107 17:27530163-27530185 CTAAAGACCCAGCAGGGGCTGGG + Intronic
1146217935 17:30993498-30993520 CTTAAAATTCACTAGGGGCTCGG - Intronic
1147773460 17:42883748-42883770 GTTAAGAGGCATAAGGGGCTGGG - Intergenic
1148421659 17:47553069-47553091 CTTAAGATCCTTGAGGGGCTGGG + Intronic
1150167905 17:62962531-62962553 CTTAAGAGACATAGAGGGCTGGG + Intergenic
1151908511 17:77065683-77065705 CTTAGGAAAGATTATGGGCTGGG - Intergenic
1154212945 18:12395562-12395584 TTTAAGAGGCAATAGGGGCTGGG - Intergenic
1158813356 18:61063882-61063904 ATTAGGACACATTAGGATCTGGG - Intergenic
1159611950 18:70535569-70535591 CTATAGTCACATTAGGGGTTAGG + Intergenic
1159879624 18:73846147-73846169 CTTTAAACAAGTTAGGGGCTGGG + Intergenic
1165024569 19:32950261-32950283 CTTAAAAAGCATTAGGGGCCAGG + Intronic
1166531299 19:43545106-43545128 CTGATGCCACTTTAGGGGCTTGG + Intronic
1167226975 19:48251587-48251609 TTTAATATACATTTGGGGCTTGG + Intronic
1167227090 19:48252925-48252947 TTTAATATACATTTGGGGCTTGG + Intronic
925154926 2:1641441-1641463 AAAAAGACACATTGGGGGCTGGG - Intronic
925259196 2:2515437-2515459 CTGAATACACATGAGGGGCCAGG - Intergenic
925317651 2:2938120-2938142 CATCAGACACAAAAGGGGCTGGG - Intergenic
925659855 2:6190897-6190919 TTTAAGACACAAGAGGAGCTGGG - Intergenic
925803808 2:7628840-7628862 TTTAAGACACCTTGGGGGATAGG - Intergenic
930252243 2:49047785-49047807 CTTAAGAAACATGAGGTGATGGG + Intronic
933621921 2:84553229-84553251 CTTGAGTCAGATTAGAGGCTTGG + Intronic
934793199 2:97080970-97080992 CTTAAGAAGCTTTGGGGGCTGGG + Intergenic
934812991 2:97299573-97299595 CTTAAGAAACTTTGGGGGCTGGG - Intergenic
934824704 2:97408907-97408929 CTTAAGAAACTTTGGGGGCTGGG + Intergenic
937642641 2:124230825-124230847 TTTAAAACACATTAGAGGCTGGG - Intronic
938820904 2:134959344-134959366 CTTAAGACATGTTAGAGCCTTGG - Intergenic
940090112 2:149905841-149905863 CTAAAGAAACAATAGCGGCTGGG + Intergenic
940324019 2:152406016-152406038 CTTAAGACAGATTTTGGGCAAGG + Intronic
940367067 2:152860258-152860280 GTTAAGACAAATTTGAGGCTGGG + Intergenic
941055780 2:160786254-160786276 CTTCAGACACATAAGAGTCTAGG - Intergenic
941293824 2:163710703-163710725 CTTATGACACAATAGGGATTTGG + Intronic
946876595 2:224135766-224135788 CTTTATTCACATTAGGGGCATGG + Intergenic
947754495 2:232551608-232551630 CTCAAACCACATTAGTGGCTAGG + Intronic
1169713253 20:8588452-8588474 ATAAAGTCACATTAGGGGTTAGG - Intronic
1170675017 20:18471038-18471060 TTTAAGACAGATCAGGGGCCAGG - Intronic
1171876717 20:30584694-30584716 GTTAAGAGACGTTAGGGGTTAGG - Intergenic
1172102540 20:32493955-32493977 CTTCAGACAAATTACTGGCTAGG + Intronic
1176269697 20:64229779-64229801 ATTAAGTCACATCAGGCGCTTGG + Intronic
1177596928 21:23256499-23256521 CTTTAGAAACATCAGGAGCTAGG - Intergenic
1178297218 21:31420477-31420499 CTTTAGACTCTTTAGGGTCTGGG - Intronic
1178363789 21:31971580-31971602 CTTAAAATACATCTGGGGCTAGG - Intronic
1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG + Exonic
1182400656 22:30074313-30074335 CTTAAGAGGCATTGGGGGCTGGG - Intergenic
1182633155 22:31703109-31703131 CTTAAAACACAGCAGGGGCCAGG - Intronic
1184512880 22:44943371-44943393 CTCAAAACAAAATAGGGGCTTGG - Intronic
952324628 3:32309817-32309839 CCTAAGTCACAGTAGGGGATGGG + Intronic
953611713 3:44452526-44452548 CTTAAAAGACAGTGGGGGCTGGG - Intronic
953960597 3:47263190-47263212 AATAAGACAGATTAGGGGCCGGG - Intronic
954990489 3:54836804-54836826 CTTAAGAAACATAAGTGTCTGGG + Intronic
955747346 3:62153297-62153319 GTTAACAGACATAAGGGGCTTGG - Intronic
960102032 3:113753903-113753925 CTTAAGATACATGATGGCCTGGG - Intronic
963905741 3:150772292-150772314 CTTAAAACACATAATAGGCTGGG - Intergenic
965350643 3:167607758-167607780 CTCAAGATAAATTAGGGGCTTGG - Intronic
965740148 3:171865678-171865700 CTCAAGACACAGTACGTGCTGGG + Intronic
976043754 4:80919820-80919842 CTTTTGACACATGAGGGACTTGG - Intronic
976754862 4:88487361-88487383 CTTAAGGCAAATTAGGGCCTTGG + Intronic
981140742 4:141265903-141265925 ATTAAAACATATTATGGGCTGGG + Intergenic
991054977 5:62310347-62310369 TTTAAGAGTCATTAGAGGCTGGG - Intronic
991511876 5:67387123-67387145 CATAAGCCATATTAGGGGCTGGG - Intergenic
992120039 5:73583570-73583592 ATTGAGACACATTAGAGGCCAGG + Intergenic
993363620 5:87007677-87007699 CTTAAAACACAGTTGAGGCTGGG - Intergenic
993852008 5:93022221-93022243 CTGGAGACAGATGAGGGGCTGGG + Intergenic
993855071 5:93064181-93064203 CTAAAGACACATTGAGGGTTAGG + Intergenic
997868905 5:137489668-137489690 CTTAACACACATTTGGGGGCAGG - Intronic
1001496624 5:172192453-172192475 ATTAAGACAGAGGAGGGGCTGGG + Intergenic
1002935473 6:1668412-1668434 TTTAAGACACACTGGGGGCCAGG + Intronic
1003125191 6:3350228-3350250 TTTATGACACATTAGGGCTTGGG - Intronic
1005200228 6:23336342-23336364 ATAAAGAGACATTGGGGGCTGGG + Intergenic
1007549606 6:42718958-42718980 CTAAAGACACAATTAGGGCTGGG - Intronic
1008312234 6:49990259-49990281 CTTTGGACACGTTAGGGCCTGGG + Intergenic
1010221067 6:73449698-73449720 CTCAAGACACAGTCTGGGCTGGG + Intronic
1010770585 6:79824332-79824354 GTGAAGACAGATGAGGGGCTGGG + Intergenic
1011954869 6:93014946-93014968 CTAAAGACACACTAGGTCCTGGG + Intergenic
1012591991 6:100993159-100993181 CTTAAGAAACATTTGGGGCTTGG - Intergenic
1016760306 6:147729259-147729281 ATAAAGTCACATTTGGGGCTAGG + Intronic
1020841305 7:13221378-13221400 CTTAAAACATATCTGGGGCTGGG + Intergenic
1025247333 7:57327201-57327223 CTAAAGACCCAGGAGGGGCTGGG + Intergenic
1026347357 7:69485733-69485755 CTTAAATCACAACAGGGGCTGGG + Intergenic
1027699745 7:81455282-81455304 CTTAAAACAAATTAGGGAGTAGG + Intergenic
1028551979 7:92078324-92078346 ATTAAGACACATTGGTGGCCAGG + Intronic
1029126492 7:98298315-98298337 TTTAAAAAACATTAGGGGCTGGG + Intronic
1029297143 7:99550596-99550618 CTTAGGACACATTTGAGACTTGG + Intronic
1031638088 7:124126623-124126645 CTGAAAAGATATTAGGGGCTGGG + Intergenic
1033708399 7:143911328-143911350 CTTAGTGCAAATTAGGGGCTTGG + Intergenic
1034915253 7:155033588-155033610 TTTAAGACACAATCGGGGCCAGG - Intergenic
1036391769 8:8330068-8330090 CATAAGACTCAACAGGGGCTGGG + Intronic
1038259965 8:25984384-25984406 CATAAGACCCATTCGCGGCTGGG + Intronic
1039453194 8:37692144-37692166 TTTAAGACACATTGCGGGCTGGG + Intergenic
1042942598 8:74122937-74122959 CATAAGAAAGATTAGAGGCTTGG - Intergenic
1043256147 8:78139062-78139084 TTTGAGACACATTAGAAGCTGGG + Intergenic
1043984594 8:86679392-86679414 ATTCAGTCACATTAGGGGTTAGG - Intronic
1045845826 8:106634945-106634967 CTTAAGATTCAGTAGGGTCTGGG - Intronic
1047013993 8:120702954-120702976 CTTAATACACACAAAGGGCTTGG + Intronic
1049248760 8:141577113-141577135 CTTAAGAAAGAGTGGGGGCTGGG - Intergenic
1050076439 9:1870556-1870578 GATGAGAAACATTAGGGGCTTGG - Intergenic
1050739542 9:8804246-8804268 ATTAAGAGAAATGAGGGGCTGGG - Intronic
1053261383 9:36668296-36668318 TTTAAAAGAGATTAGGGGCTTGG - Intronic
1055354427 9:75423427-75423449 ACTAAGCCACATGAGGGGCTGGG + Intergenic
1058383266 9:104403331-104403353 ATACAGCCACATTAGGGGCTAGG + Intergenic
1060132680 9:121119787-121119809 CTTAAGAAAGATGAAGGGCTGGG - Intronic
1061038498 9:128126561-128126583 CTTAAAACACGGTAGAGGCTGGG + Intronic
1186577594 X:10783033-10783055 CTTAATAGCCATCAGGGGCTAGG - Intronic
1187456442 X:19445293-19445315 ATTAAGAAAAATTAGGGGCCAGG + Intronic
1187694237 X:21902486-21902508 ATTATGACAAATTAGAGGCTAGG - Intergenic
1188214872 X:27463568-27463590 TTTAAGAGACAGTAGGGGATGGG - Intergenic
1188458016 X:30389373-30389395 TTTAAGACACACTAGGGGCTGGG - Intergenic
1190434207 X:50407622-50407644 CCAAAGTCACATTAGGGGTTAGG + Intronic
1192182497 X:68925089-68925111 CAAAAGACACATCAGGGGCTGGG - Intergenic
1194062457 X:89221281-89221303 AAAAAGACACATTATGGGCTGGG - Intergenic
1200716325 Y:6550247-6550269 AAAAAGACACATTATGGGCTGGG - Intergenic
1201636672 Y:16130361-16130383 CTTAGGACACATTAAATGCTGGG + Intergenic