ID: 1107458052

View in Genome Browser
Species Human (GRCh38)
Location 13:40573256-40573278
Sequence GACACAGATGTGCCCACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107458052_1107458054 -7 Left 1107458052 13:40573256-40573278 CCAGATGTGGGCACATCTGTGTC 0: 1
1: 0
2: 3
3: 17
4: 176
Right 1107458054 13:40573272-40573294 CTGTGTCAGAGGTGCCCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 191
1107458052_1107458058 19 Left 1107458052 13:40573256-40573278 CCAGATGTGGGCACATCTGTGTC 0: 1
1: 0
2: 3
3: 17
4: 176
Right 1107458058 13:40573298-40573320 TTCAGCTTAAATGCAGTCTCAGG 0: 1
1: 0
2: 1
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107458052 Original CRISPR GACACAGATGTGCCCACATC TGG (reversed) Intronic
900421283 1:2557014-2557036 CCCCCAGAAGTGCCCACATCCGG - Intronic
900630743 1:3633884-3633906 GGCACAGATGCCCCCACCTCGGG - Intronic
901032172 1:6313584-6313606 CCCACAGATGTGGCCACATGAGG + Intronic
901759151 1:11459405-11459427 GGCACAGCTGTGCCCAGATAGGG - Intergenic
906001451 1:42429769-42429791 GATATAGCTGTGGCCACATCTGG + Intergenic
906253151 1:44326970-44326992 GACACAGGTGTGCACACCTCAGG - Intronic
916342228 1:163749377-163749399 GACACTGATGTATACACATCAGG + Intergenic
916622202 1:166511328-166511350 AAGACTGAGGTGCCCACATCTGG + Intergenic
919731834 1:200917636-200917658 GGCACACATCTGCCCACTTCTGG + Intergenic
922175051 1:223190243-223190265 GACAGAGATGGGACAACATCTGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923546735 1:234928797-234928819 GGCACAGGTGTGCACACACCTGG + Intergenic
1063656858 10:7999320-7999342 GAGACAGATCTGCACACAACTGG + Intronic
1063970086 10:11375665-11375687 GTCACAGCTGTGTCCTCATCTGG - Intergenic
1065130863 10:22618778-22618800 GACACAGAATTACCCACATTAGG + Intronic
1067223792 10:44362691-44362713 GCCCCAGATGTGGCCGCATCTGG + Intergenic
1067223797 10:44362694-44362716 GCCCCAGATGCGGCCACATCTGG - Intergenic
1069078975 10:64067814-64067836 GATACAGATCTGGCCACACCAGG - Intergenic
1070826625 10:79394011-79394033 GACAGAGATGTGCGGACAGCAGG - Intronic
1072573782 10:96681174-96681196 GACACAGATGTGTGCACACACGG - Intronic
1073050445 10:100663605-100663627 GACTCAGATGTGCCAAAAGCAGG + Intergenic
1073454889 10:103630404-103630426 ACCACAGATGTGGGCACATCTGG + Intronic
1074899969 10:117807603-117807625 CACACAGATGTGGCTACCTCTGG + Intergenic
1075489995 10:122858599-122858621 TACACACCTGTGCCCACAGCAGG + Intronic
1075504115 10:123007616-123007638 GATTCAGATGTGCCCTTATCGGG - Intronic
1076063795 10:127432530-127432552 GTCCCAGATGTGCCAACATCTGG + Intronic
1076450644 10:130554784-130554806 GAGACAGATGTGCCCACCACTGG - Intergenic
1076618863 10:131774332-131774354 GACACAGATGTATCCAGTTCTGG - Intergenic
1076631886 10:131856542-131856564 GTCACAGCTGTGCCCAGGTCGGG + Intergenic
1080386625 11:31814387-31814409 GGCAAAGAAGTGCCCACTTCTGG + Intronic
1081499237 11:43649614-43649636 GACACAGTTGTGGCCACCTTTGG - Intronic
1081525994 11:43928175-43928197 GAGGAAGATGGGCCCACATCAGG + Intronic
1081535527 11:43993413-43993435 GACACAGCTCAGCCCACTTCTGG - Intergenic
1084957336 11:72698283-72698305 CACTCAGATGTGCCCGCCTCTGG + Intronic
1085449584 11:76623859-76623881 GGTCCAGAAGTGCCCACATCAGG - Intergenic
1086420197 11:86631035-86631057 GTCACAGATGAGCCCAGGTCTGG + Intronic
1086436961 11:86791174-86791196 GACACAGATTTGCCTTCATCTGG + Intronic
1086595076 11:88560947-88560969 CTCACAGATTTTCCCACATCTGG - Intronic
1088231386 11:107676900-107676922 GATGCAAATGTGACCACATCAGG - Intergenic
1088512595 11:110593655-110593677 GAGACAGAGGTACCCACAGCTGG + Intronic
1088688626 11:112305709-112305731 GGCACTGATGTGACCAGATCTGG + Intergenic
1089522286 11:119073154-119073176 GACAGAGATGTCCAAACATCTGG + Intronic
1089609508 11:119661544-119661566 GACACGGATGTCCCCTCTTCTGG - Exonic
1089745565 11:120614461-120614483 GAGACAGAGGTGCCTGCATCTGG + Intronic
1090900453 11:131026326-131026348 GACAGACATGTGCCCAATTCTGG - Intergenic
1091074346 11:132601178-132601200 TTCACAGCTGTGCCCACATGGGG - Intronic
1095945279 12:47750093-47750115 GACAAAGATGTGGCCAGGTCAGG + Intronic
1096980779 12:55727420-55727442 GACACAGACTTGACCCCATCCGG + Intronic
1097968889 12:65611003-65611025 GACTCAGTTGTGGCCACTTCTGG + Intergenic
1102999030 12:117371076-117371098 CTCACAGATGTGCCCTCCTCTGG - Intronic
1104795116 12:131511825-131511847 GACACAGATGTGGCCAGAGAAGG - Intergenic
1104810838 12:131619428-131619450 CACACAGATGTGCACACACATGG + Intergenic
1104984454 12:132588721-132588743 GACACAGAGGTGGCCACCTGAGG - Intergenic
1105024936 12:132841805-132841827 GAAACAGAAGTGCAAACATCTGG + Intronic
1105273098 13:18895620-18895642 GACCCCGATGAGCCCACTTCAGG - Intergenic
1105472757 13:20706843-20706865 CACCCAGATCTGCCCACATGTGG + Intronic
1105756564 13:23470244-23470266 TACACAGCTTTGGCCACATCAGG + Intergenic
1105793812 13:23831107-23831129 GACACATATATTCACACATCTGG + Intronic
1107256776 13:38436861-38436883 GACACACATGCCACCACATCTGG - Intergenic
1107458052 13:40573256-40573278 GACACAGATGTGCCCACATCTGG - Intronic
1107911645 13:45110964-45110986 GACAGAGATGTGTCCACCTTGGG + Intergenic
1109186253 13:59272138-59272160 GAGACAGATGTGCCCAGAGAGGG + Intergenic
1109311369 13:60697970-60697992 GAAACAGATGTTTCCACATTTGG - Intergenic
1112133870 13:96553646-96553668 TGCACAGATGTGCCCACATTTGG + Intronic
1112258718 13:97858342-97858364 AACACAGCTGTGGCCACATATGG - Intergenic
1112567736 13:100565753-100565775 CACACAGAAGTCCCCACAGCTGG - Intronic
1113701765 13:112393739-112393761 GACACAGATGAGGCCAAAGCGGG + Intronic
1115772190 14:36676213-36676235 GACACAAAACTGCCCACAGCTGG - Exonic
1117046635 14:51819070-51819092 GACACAGATCTGCTCACTGCAGG - Intergenic
1122262684 14:100532062-100532084 GACACAGACAGGCCCACATCTGG - Intergenic
1122441358 14:101734448-101734470 GACACAGCTGTGCCCTCCACAGG + Intergenic
1122969568 14:105147044-105147066 GCCACAGAGGAGCCCACGTCAGG + Intronic
1124183297 15:27498804-27498826 GTCAAAGATGAACCCACATCTGG - Intronic
1125236681 15:37522807-37522829 TAAACAGATGTGCTCTCATCTGG + Intergenic
1127734143 15:61826759-61826781 GACACAGATCCACCCACTTCAGG + Intergenic
1129231813 15:74201274-74201296 AGAACAGATGTGCACACATCTGG + Intronic
1131413416 15:92230285-92230307 AACATAGGAGTGCCCACATCTGG - Intergenic
1136013607 16:27381199-27381221 GACCCAGATGTGCACACCACAGG - Intergenic
1140176635 16:72667209-72667231 GACACAGGTGTGCACACACATGG - Intergenic
1141591754 16:85073734-85073756 GGTACAGATATGCCCAGATCAGG - Intronic
1145311038 17:21701191-21701213 GCCACTGATGTGCCCACCCCCGG - Intronic
1149999399 17:61424183-61424205 GACACAGTTGTGCCCTCAGGGGG + Intergenic
1150382604 17:64732631-64732653 GAGAGCGAGGTGCCCACATCTGG + Intergenic
1151049301 17:70958670-70958692 TACACAAATGTGCGTACATCAGG + Intergenic
1151449001 17:74185965-74185987 GACAGAGGTGAGCCCACACCTGG + Intergenic
1152701134 17:81820201-81820223 GACCCAGGTGAGCCCAAATCAGG + Intergenic
1154464862 18:14633182-14633204 GACCCCGATGAGCCCACTTCAGG - Intergenic
1156490648 18:37493965-37493987 GACAGAGATGTGCACAGAGCTGG + Intronic
1156844086 18:41643545-41643567 TACACACATGTGCTCACATATGG + Intergenic
1160458351 18:79018881-79018903 GACACAGCTGAGCCCACAACAGG + Intergenic
1161133912 19:2608519-2608541 GGCACAGGTGTGCCTGCATCTGG - Intronic
1161386649 19:3997921-3997943 GACACAGTGGTGACCACAACAGG - Intergenic
1161816281 19:6501909-6501931 GTCACAGCTGGGCCCACAGCTGG - Intronic
1164039600 19:21483358-21483380 GACACACATGGGCCCGCAACCGG - Intronic
1164311216 19:24048164-24048186 GCCACAGCTCAGCCCACATCTGG - Intronic
1167676018 19:50886395-50886417 GACACATATGTGACCACACAAGG - Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
924992932 2:329442-329464 GACACTGATGTCCACTCATCTGG - Intergenic
925122050 2:1427174-1427196 CACACAGAAGGGGCCACATCTGG + Intronic
925588529 2:5487340-5487362 GACTCAGATGTGCTCACTTCAGG + Intergenic
926895313 2:17680750-17680772 TAAACAGATGTGCTCTCATCAGG + Intronic
927057367 2:19378083-19378105 GCCCCAGATGTGGCCACATCAGG - Intergenic
927195306 2:20542582-20542604 GACACAGATGTGTCCAAACCTGG + Intergenic
929758728 2:44788811-44788833 GAATCAGATGTGCCTGCATCTGG - Intergenic
935373413 2:102370865-102370887 GACACATTTGTGCCCACCTTAGG - Intronic
937900368 2:127015380-127015402 CACACAGATTGGCCCGCATCAGG - Intergenic
938225307 2:129610908-129610930 GACACACATATGCCCTCACCCGG + Intergenic
938783199 2:134603785-134603807 GGCACTGTTTTGCCCACATCTGG + Intronic
939829299 2:147053472-147053494 GGCACAGATGTGGCCACAAGAGG - Intergenic
940790480 2:158025731-158025753 TACACAGATGTGTACACATATGG - Intronic
944588193 2:201191532-201191554 AACACAGATGTTTCCACACCAGG + Intronic
944693110 2:202175913-202175935 GAAATAAATGTGCCCACATATGG + Intronic
945033377 2:205685058-205685080 GGGACAGATGTGCGAACATCTGG - Intronic
947468229 2:230373508-230373530 TAAACAGATGTGCTCTCATCTGG - Intronic
948145523 2:235705337-235705359 AACACAGGTGTGCACACATCCGG + Intronic
948309771 2:236976481-236976503 CACACAGATGTGTCCTCACCAGG + Intergenic
948782634 2:240332180-240332202 GGCACAGATGTGCAGCCATCTGG + Intergenic
948965455 2:241376230-241376252 GACACTGCAGTGCCCACTTCTGG - Intronic
949067409 2:242001599-242001621 GACACAGAGGTCCCCAGAGCAGG - Intergenic
1171423447 20:25034228-25034250 GACAGAGATGTGGCCCCATGAGG - Intronic
1172134270 20:32676398-32676420 GACTCAGATGACCCCACAGCTGG - Intergenic
1173601418 20:44298138-44298160 GACACAGACCTGCCCTCAGCAGG - Intergenic
1174601029 20:51724969-51724991 GGCACAGATGTCCCCCAATCTGG - Intronic
1175506169 20:59485884-59485906 GACAAACATTTGCACACATCAGG + Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1176809674 21:13525201-13525223 GACCCCGATGAGCCCACTTCAGG + Intergenic
1179265439 21:39798574-39798596 GACACAGATGTGTACAACTCAGG - Intronic
1179638650 21:42732153-42732175 GAGAAAGATGTGCCCATCTCTGG - Intronic
1180220801 21:46356613-46356635 GACACATGTGTGCCCACATCTGG + Intronic
1181585002 22:23848332-23848354 AATACAGCTGTGCCCACATCTGG - Intergenic
1184473090 22:44706997-44707019 GGCAGAGATGTGTCCCCATCGGG + Intronic
1184842362 22:47059524-47059546 GACACAGACTTGCTCACATTGGG - Intronic
1185033226 22:48456735-48456757 GACACACACGAGCCCACAACCGG + Intergenic
954636817 3:52075402-52075424 GACTCAGATGGGCCCACTTTGGG + Exonic
955804936 3:62723978-62724000 GACACAGAAGTGCCCACATAAGG - Intronic
955878650 3:63520942-63520964 GACACAAATGTGCAAACATTTGG - Intronic
962915909 3:139903111-139903133 GACATAGATATGACTACATCAGG - Intergenic
963124940 3:141807346-141807368 GTAACAGATTTTCCCACATCAGG + Intronic
965617920 3:170613581-170613603 GAGGCAGATGTGCTCACTTCAGG + Intronic
966139923 3:176745378-176745400 CCCACAGCTGTGCCCACATCTGG + Intergenic
968576303 4:1367815-1367837 GCCCCAGCTGTGCCCTCATCGGG + Intronic
968597212 4:1491717-1491739 GACTCAGCTGTGCCACCATCAGG + Intergenic
971153612 4:24059607-24059629 GACACAGCTGTGCTCAGATGCGG - Intergenic
975594897 4:76040694-76040716 GACAAAGATGTGTCTACATGGGG - Intronic
976854788 4:89590861-89590883 GACATAGATGTGGCCACATCTGG + Intergenic
979982463 4:127273621-127273643 GTCACACATGTTCCCTCATCTGG - Intergenic
982488092 4:155993302-155993324 TACACAGATGTGCTTTCATCCGG + Intergenic
985003829 4:185512933-185512955 GACACAGAGCTGCCAGCATCGGG + Intronic
985063603 4:186101568-186101590 AACTCAAATGTGCCCACAGCTGG + Intergenic
985538298 5:476399-476421 GTCACAGCTGTGCCCACCGCCGG + Intronic
986316094 5:6587468-6587490 GACACTGCTGTGCTGACATCTGG - Intergenic
992091057 5:73317367-73317389 GACAGAGATGTTCCCACATGGGG - Intergenic
993092981 5:83449997-83450019 CACACATATGTGCCCACACATGG + Intergenic
993858338 5:93102892-93102914 GAAGCAGTTGTGTCCACATCTGG + Intergenic
993991003 5:94659543-94659565 TACACCAATGTGCTCACATCTGG - Intronic
996152720 5:120059465-120059487 GACATATATGTGCCCAAATTAGG - Intergenic
996949866 5:129112585-129112607 GACATATATGTGCCCAGAACAGG - Intronic
998069635 5:139187168-139187190 GATACAGATGAGGACACATCAGG + Intronic
1001276397 5:170354674-170354696 GCCCCAGATGGGCCCACAGCCGG + Intronic
1002644621 5:180647054-180647076 GCCACACATCTGTCCACATCTGG + Intronic
1004247686 6:13995911-13995933 GACATCAATGTGCCCACTTCTGG - Intergenic
1004265635 6:14146217-14146239 GGCACCAGTGTGCCCACATCTGG + Intergenic
1004423371 6:15490886-15490908 GAATCACATGTGGCCACATCTGG - Intronic
1006186255 6:32183185-32183207 GACACACATGTCCCCACCTGGGG + Exonic
1012260843 6:97085596-97085618 GACTCAGATGTGACCACGTTAGG - Intronic
1014254788 6:119150154-119150176 GACACAGAGGTACCCACACAAGG + Intergenic
1014406093 6:121052888-121052910 TACACAACTGTGCTCACATCTGG - Intergenic
1018765405 6:166929044-166929066 GACACACCTGTGACCACACCAGG + Intronic
1018786043 6:167108734-167108756 GGCCCAGATGTGCCCACTTTGGG + Intergenic
1018818378 6:167353078-167353100 TAAACAGATGTGCTCCCATCCGG - Intronic
1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG + Intergenic
1022468271 7:30665704-30665726 GACACAGAGGTGGCCACGGCTGG - Intronic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1023149171 7:37183612-37183634 AGCACAGATGTGCTCACAGCAGG + Intronic
1024553201 7:50580881-50580903 GGCACAGATCTCACCACATCTGG - Intergenic
1029626686 7:101724367-101724389 GACCCTGATGTGCTCACCTCAGG + Intergenic
1030954191 7:115830208-115830230 GACAGAAATCTGCCCACATGAGG - Intergenic
1034276302 7:149825332-149825354 CACACAGCTGTGCCGACCTCTGG + Intergenic
1035604246 8:919309-919331 GAGACAGAGCTGCCGACATCAGG + Intergenic
1038751424 8:30299672-30299694 GAAACACATGTGTCCACATGGGG + Intergenic
1039162151 8:34634264-34634286 AACACAGATGTCCCTACAACAGG + Intergenic
1044537204 8:93370883-93370905 GACACAGATGTGGCTACACAGGG + Intergenic
1044580755 8:93823650-93823672 GACAAGGATGCCCCCACATCAGG - Intergenic
1045512167 8:102820286-102820308 GAGGCTGATGGGCCCACATCTGG - Intergenic
1048508128 8:135039202-135039224 CACACAGATGAGGTCACATCTGG - Intergenic
1049225583 8:141449074-141449096 AACACAGCTGTGGCCTCATCAGG + Intergenic
1051528669 9:18075825-18075847 GGCACAGGTCTGCCCACAGCAGG - Intergenic
1057422744 9:94925673-94925695 GACACTGATGTGCACACTGCTGG - Intronic
1058385856 9:104435034-104435056 GAAACAGATGTGAGCACATTGGG - Intergenic
1060586884 9:124792222-124792244 AACACACATGTGCCTAGATCAGG - Intronic
1060586905 9:124792358-124792380 GACACACAGGTGCCTAAATCAGG - Intronic
1060586918 9:124792430-124792452 AACACACAGGTGCCCAGATCTGG - Intronic
1062244904 9:135561284-135561306 GACACAGGTGTGCACACCTGGGG + Intergenic
1189058928 X:37730966-37730988 GACATACATGTGCCCAAAGCTGG - Exonic
1193792777 X:85836309-85836331 GACATAGATGCTCCCACCTCTGG - Intergenic
1197457581 X:126697059-126697081 GAGACAGAAGTTCCCACAGCTGG + Intergenic
1198731515 X:139735427-139735449 GACACACATTTGACCACATCGGG + Intronic