ID: 1107461913

View in Genome Browser
Species Human (GRCh38)
Location 13:40612264-40612286
Sequence GGGAAGCCTGGATTTTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107461913_1107461924 12 Left 1107461913 13:40612264-40612286 CCCCAACAAAATCCAGGCTTCCC 0: 1
1: 0
2: 1
3: 18
4: 217
Right 1107461924 13:40612299-40612321 AGGGTTCTAGAAAGCTCAAATGG 0: 1
1: 0
2: 2
3: 20
4: 180
1107461913_1107461917 -8 Left 1107461913 13:40612264-40612286 CCCCAACAAAATCCAGGCTTCCC 0: 1
1: 0
2: 1
3: 18
4: 217
Right 1107461917 13:40612279-40612301 GGCTTCCCCACCTCTCCTACAGG 0: 1
1: 0
2: 1
3: 19
4: 182
1107461913_1107461918 -7 Left 1107461913 13:40612264-40612286 CCCCAACAAAATCCAGGCTTCCC 0: 1
1: 0
2: 1
3: 18
4: 217
Right 1107461918 13:40612280-40612302 GCTTCCCCACCTCTCCTACAGGG 0: 1
1: 1
2: 0
3: 23
4: 204
1107461913_1107461925 27 Left 1107461913 13:40612264-40612286 CCCCAACAAAATCCAGGCTTCCC 0: 1
1: 0
2: 1
3: 18
4: 217
Right 1107461925 13:40612314-40612336 TCAAATGGACAGAGCACAGCAGG 0: 1
1: 1
2: 3
3: 14
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107461913 Original CRISPR GGGAAGCCTGGATTTTGTTG GGG (reversed) Intronic
904751516 1:32743456-32743478 GGGAGGACTGGATTTGGGTGAGG + Intronic
907345290 1:53772955-53772977 GGCAAGTCTGGATTTTGGGGGGG - Intronic
908652140 1:66345927-66345949 GTGAAGCATGGTTTTGGTTGGGG + Intronic
911330836 1:96523786-96523808 GGGGAGCCTTGCTTTGGTTGTGG + Intergenic
914245603 1:145883677-145883699 GGGAAGCCAGGCTTTTGGAGTGG + Intronic
915084162 1:153373748-153373770 GGCAAGGCTGGGTTTTGGTGAGG + Exonic
915229198 1:154433132-154433154 TGGAAGCCTGGGTGGTGTTGGGG + Intronic
915377622 1:155411224-155411246 GTGAAGCCAGGATATTATTGTGG - Intronic
915467113 1:156104255-156104277 GTGTAGGCTGGCTTTTGTTGGGG + Intronic
915724447 1:158007695-158007717 GGGCAGCCTGGGTTTGCTTGAGG + Intronic
916486510 1:165264593-165264615 GGGATGTCTGCATTTTGCTGCGG + Intronic
917843727 1:179003138-179003160 GGGTAGGATGGATTTTGATGGGG + Intergenic
918024912 1:180733714-180733736 GGGAAGACGGGATTTTATTTGGG + Intronic
919618309 1:199835082-199835104 GGGAAGCCTGGACTTCCATGTGG + Intergenic
919858406 1:201721146-201721168 GGGAAGCCTGGAGTTTGCATGGG + Intronic
920714792 1:208329677-208329699 AGGAAGACTAGATTATGTTGTGG - Intergenic
923174458 1:231450356-231450378 GGTTAGCCAGTATTTTGTTGAGG - Intergenic
923573393 1:235136749-235136771 GAGGAGTCTGGATTTTGTTCAGG - Intronic
924319006 1:242828535-242828557 GGGAAGCCTGGCATGAGTTGGGG + Intergenic
924711622 1:246534171-246534193 GTCCAGCCTGGATTTTGTAGGGG - Intergenic
924749937 1:246877272-246877294 TTGAAGCCTGGAATTTTTTGCGG - Exonic
1065908793 10:30283430-30283452 TGGAAGCCTGCCTTCTGTTGGGG - Intergenic
1067103590 10:43350603-43350625 GGGCAGCCTGGACTTTATGGGGG - Intergenic
1069456674 10:68559698-68559720 GGGAATCCAGGATTTTAATGGGG - Intergenic
1069771055 10:70900745-70900767 GAGAAGTGTGGATTTTGATGTGG + Intergenic
1072360265 10:94652683-94652705 GGGAAGCCTGGGTCTTCTTGAGG + Intergenic
1072853859 10:98925799-98925821 GAGAAAACTGGCTTTTGTTGGGG + Intronic
1073166030 10:101452776-101452798 GGGAGGCCTTGATGTGGTTGTGG + Intronic
1073372094 10:102999625-102999647 GGGCAGCCTGGATTTTGATAAGG - Intronic
1075540924 10:123313269-123313291 GGGAAGCCTGCATTTTCCTTGGG - Intergenic
1080771872 11:35349192-35349214 GGGAAGCCTGCATTGAGGTGTGG + Intronic
1080892477 11:36421307-36421329 GGGAAGCCTTGAGGTTTTTGGGG + Intronic
1083350230 11:62022747-62022769 GGGAAGCCTGGATTTATAGGCGG + Intergenic
1083505000 11:63148419-63148441 GGGAAGCCAGGGTATTGTGGAGG + Intronic
1085119715 11:73959250-73959272 GGAAAGCCTTGAGTTTGCTGGGG - Intronic
1085640302 11:78188983-78189005 GGGAAGACTGGATTTTGCAGTGG + Exonic
1085865875 11:80291410-80291432 GAGAAGTCAGGATTTTGTTTTGG - Intergenic
1089400422 11:118161180-118161202 GGGAAGGCTGGATTTGGTTCAGG - Intergenic
1091158602 11:133398173-133398195 GGGAGGTCTGAATTTTGTGGTGG - Intronic
1091916740 12:4275323-4275345 GGGAAGCCTGGCTCTTCTTTGGG + Intronic
1092022491 12:5214195-5214217 AGGAAGCCTGAGTTTGGTTGTGG + Intergenic
1095843533 12:46720982-46721004 GGGGAGCCTGGAGTTTCTTCAGG + Intergenic
1095889772 12:47224725-47224747 GGGAATCATGGTTGTTGTTGAGG + Intronic
1097329083 12:58313506-58313528 GGTAGGCCAGCATTTTGTTGAGG + Intergenic
1098161701 12:67651558-67651580 TGGAGGCCTGTATTTTGCTGTGG + Intronic
1101632580 12:106509972-106509994 GGTCAGCCTGGCTTTTGTCGTGG + Exonic
1103444073 12:120982487-120982509 AGGCAGTCTGGCTTTTGTTGGGG - Intronic
1103641342 12:122355092-122355114 GTGAAGTCTGGACCTTGTTGCGG - Intronic
1107461913 13:40612264-40612286 GGGAAGCCTGGATTTTGTTGGGG - Intronic
1109749869 13:66676066-66676088 TGTAACCCTGGATTTTGTTAAGG + Intronic
1114722818 14:24900486-24900508 AGGAAGCCTGGAGTTTATTTTGG - Intronic
1117357644 14:54940914-54940936 GTATAGCCTGGATTTTTTTGAGG - Exonic
1117587203 14:57221631-57221653 GGAACTCCTGGGTTTTGTTGGGG + Intronic
1117834735 14:59791841-59791863 GGTTAGCCTGGATTTTTTTTTGG + Intronic
1118650518 14:67887927-67887949 GAGAAGCCTGAATGTTGATGAGG - Intronic
1119604488 14:76002886-76002908 GGGAAGCCAGGATTTAGGAGAGG + Intronic
1123493799 15:20802836-20802858 GGAAAGCCAGCATTTAGTTGGGG + Intergenic
1123550298 15:21371918-21371940 GGAAAGCCAGCATTTAGTTGGGG + Intergenic
1123944305 15:25231584-25231606 GGGAAGCCTGCATCCTATTGGGG + Intergenic
1128796548 15:70470578-70470600 GGGGAGACTGGTTTTTATTGTGG + Intergenic
1130221176 15:82020888-82020910 GGCACCCCTGGATTTTGTTTTGG + Intergenic
1131305559 15:91240073-91240095 GGGAACCCTGGCTTTTGTTCAGG - Intronic
1202958640 15_KI270727v1_random:99172-99194 GGAAAGCCAGCATTTAGTTGGGG + Intergenic
1133806238 16:9127780-9127802 GGGAACCCTGTATTTTCCTGTGG + Intergenic
1134690613 16:16188860-16188882 GGAAAGCCTGGGCCTTGTTGAGG + Exonic
1137002766 16:35245725-35245747 GTGAAACCTGCATTTTGTAGAGG - Intergenic
1137019052 16:35405547-35405569 GTGAACCCTGCATTTTGTAGAGG - Intergenic
1139262334 16:65606705-65606727 GGGAAATTTGGATTTAGTTGTGG - Intergenic
1140324361 16:73987382-73987404 GGGCCACCTGTATTTTGTTGAGG - Intergenic
1141154446 16:81587469-81587491 GGGAAGCAAGGACTTTGTGGTGG - Intronic
1141312907 16:82932923-82932945 GGGAAGCCATGATTTAGTAGAGG + Intronic
1142235730 16:88921621-88921643 GGGAGGCCTGGATTTTGTCCAGG + Intronic
1143136434 17:4715084-4715106 GGGAAGGCTGGGCTTTGTTGGGG - Intronic
1145011517 17:19370942-19370964 GGGCAGGCTGGGCTTTGTTGTGG - Intronic
1146457290 17:33017789-33017811 GGGGAGCCTGGGCCTTGTTGTGG + Intronic
1147056418 17:37838717-37838739 GGGGAGCTTGGATTTTATTGTGG - Intergenic
1147993371 17:44348709-44348731 GGGAACCCTGGCTTTTCCTGGGG + Intronic
1148742280 17:49899507-49899529 GGGCAGGCTGCTTTTTGTTGTGG + Intergenic
1149868926 17:60165774-60165796 GGGCAGCCTGTATTTTGTCTAGG - Intronic
1151779923 17:76239438-76239460 GGCAAGCCTGGGTTTTGGAGTGG - Intronic
1153497864 18:5718327-5718349 GGGAAATCTGGATTTAGCTGTGG + Intergenic
1155210713 18:23598359-23598381 GAGATGCCTGTATTTTGGTGGGG - Intergenic
1155749539 18:29403827-29403849 TGGAACTCTGGAATTTGTTGAGG - Intergenic
1156080570 18:33329687-33329709 GGGTTGCTAGGATTTTGTTGAGG + Intronic
1156306050 18:35879035-35879057 GGGAAGCCAAAATTTTGTTCAGG + Intergenic
1159290291 18:66409375-66409397 GGGAAGTCTGGACTTTTTAGTGG - Intergenic
1161198713 19:3002294-3002316 AGGCACCCTGGGTTTTGTTGGGG + Intronic
1162726070 19:12690264-12690286 TGGAAGCCTGGATTTACCTGAGG - Intronic
1163404345 19:17113041-17113063 GGGAAGCCAGCATTTGTTTGAGG + Intronic
1164619663 19:29687138-29687160 GGGCAGCCTGGATTTTCCTCTGG - Intergenic
1167427123 19:49435048-49435070 GAGAAGCCTGGATTTGGGGGTGG - Intronic
1168536811 19:57177629-57177651 AGGAAGCCTGGAAAATGTTGGGG + Intergenic
1168629270 19:57944486-57944508 GGGAAGCCAGGATTTGCCTGTGG - Intronic
927105228 2:19818407-19818429 AGGAAGTCTGGACTTTGCTGGGG - Intergenic
928665253 2:33544612-33544634 GGAAATGCTGGATTTTGTTTTGG + Intronic
929469973 2:42182032-42182054 TGGAAGCCAGGTTTCTGTTGGGG - Intronic
930060673 2:47285894-47285916 GGGAAGACTGGTCTATGTTGTGG + Intergenic
931865314 2:66404075-66404097 GTGAAGCATGGGTTTTGTTCAGG + Intergenic
931917052 2:66967757-66967779 GGGAAGAGAGGATTTTGGTGAGG + Intergenic
931921249 2:67018451-67018473 GGGATGCATGTATTTTGCTGGGG - Intergenic
931973694 2:67619120-67619142 CAGAAGCCTGGATTTTGTCAGGG + Intergenic
932040617 2:68295317-68295339 GGAAAGCCTAGATCTTGTTTTGG - Intronic
933037558 2:77419665-77419687 GGGATGACTGTATTTTGTTTGGG + Intronic
933548606 2:83744938-83744960 GAGAAGCCTGAATATTGTTGTGG - Intergenic
933707873 2:85305048-85305070 GGGCAGCCTGGGTGTTGGTGGGG + Intronic
935109540 2:100079652-100079674 GGGAAGCGTGAGTTCTGTTGGGG - Intronic
935711111 2:105899494-105899516 GGTTTGCCTGTATTTTGTTGAGG + Intergenic
937411002 2:121675445-121675467 GGTTAGCCAGTATTTTGTTGAGG - Intergenic
939200430 2:139027530-139027552 GGGAGGCTAGTATTTTGTTGAGG + Intergenic
941118832 2:161504989-161505011 TTGAAGCCTGGAATTTTTTGCGG - Intronic
944103899 2:196058788-196058810 GGGAAGCTGGGATTTTGATAGGG - Intronic
946205565 2:218104948-218104970 GGTTTGCCTGTATTTTGTTGAGG + Intergenic
948222314 2:236281186-236281208 GGTTAGCCAGTATTTTGTTGAGG - Intergenic
1169932599 20:10850683-10850705 GGCAAGCTTGGCTTTTGTGGAGG - Intergenic
1170992633 20:21317841-21317863 GGGCTGACTGTATTTTGTTGAGG + Intronic
1171421599 20:25021277-25021299 GGGACGCCTGGGTTCTGGTGAGG - Intronic
1172637868 20:36422147-36422169 GGGAAGGATGGATTCTGTGGGGG - Intronic
1174500018 20:50977470-50977492 GTAAAGCCTGGATTTTATTGTGG - Intergenic
1175867774 20:62190420-62190442 GGGAAGCCTGGATCTTGAGGAGG - Intronic
1180256125 21:46628914-46628936 GGGTAGCCTGGGTTTTCTTGGGG - Intergenic
1181370673 22:22413724-22413746 GGGTAGCTAGTATTTTGTTGAGG + Intergenic
1181843145 22:25682438-25682460 GGGAAGCCTTGATTTCTCTGAGG + Intronic
1183482422 22:38072407-38072429 GAGAAGCCAGGGGTTTGTTGGGG - Intronic
1184344963 22:43907554-43907576 AGGCAGCCTGGGTTTTGCTGTGG - Intergenic
1184567067 22:45298477-45298499 GGGGAGGCTGGATTTTATTCCGG + Intergenic
949718406 3:6960512-6960534 GGGATGCTTGGATTTTTTGGTGG - Intronic
949838159 3:8291680-8291702 AGGAAGGCTGGAGTTTGCTGGGG + Intergenic
951294833 3:20921165-20921187 GGTTAGCCAGTATTTTGTTGAGG - Intergenic
952857470 3:37784148-37784170 GGGCAGCCTGGCTTCTGTCGTGG - Intronic
953056009 3:39387719-39387741 GTGAAGCCTGGATATGGGTGAGG + Intronic
953373192 3:42407131-42407153 TGGAGGCCTGGATTATTTTGAGG - Exonic
953389132 3:42524440-42524462 GGGCAGGATGGATTTGGTTGAGG - Intronic
956278485 3:67529590-67529612 GGGAAGACTGGATTATGCGGGGG + Intronic
956506229 3:69943232-69943254 TGGATGCCTTGATTTTTTTGTGG - Intronic
957210742 3:77255097-77255119 GGGGAGACTGGATTTTCTTTTGG + Intronic
960278998 3:115759952-115759974 GGGAAACCTGCATTTTATTTAGG + Intergenic
961537436 3:127578714-127578736 GGGAAGCCTGGAGGTTGTAGTGG - Intronic
962016952 3:131451278-131451300 GGGAGGGATAGATTTTGTTGGGG - Intergenic
962694952 3:137938931-137938953 GGGATGACTGTATTTTGTTATGG + Intergenic
964162602 3:153663495-153663517 GGTTAGCTAGGATTTTGTTGAGG + Intergenic
965154324 3:165027549-165027571 GGTTAGCCAGGATTTTGTTAAGG - Intronic
966794868 3:183703756-183703778 GGGAAGAGTGGATGGTGTTGGGG + Intronic
968494945 4:910347-910369 GGGGGGCCTGCATTTAGTTGGGG - Intronic
970995289 4:22260428-22260450 GGTTTGCCAGGATTTTGTTGAGG - Intergenic
971062029 4:22982858-22982880 GGTAAGCTAGTATTTTGTTGAGG - Intergenic
973180314 4:47259189-47259211 GTGAAGGCTGGATTTGTTTGTGG - Intronic
974081194 4:57214988-57215010 GGCAAGTCTGGATTTCGATGAGG - Intergenic
975023794 4:69523988-69524010 GTGAAGCCTGAAATATGTTGAGG - Intronic
976208355 4:82642894-82642916 GGAATGTCTGGATTTTGTTCAGG + Intronic
976584458 4:86779540-86779562 AGAAAGCCTGTTTTTTGTTGGGG + Intronic
977564371 4:98566678-98566700 TGGAAGCCTGGATGCTGTGGAGG + Intronic
978409713 4:108413862-108413884 GGTTTGCTTGGATTTTGTTGAGG - Intergenic
980548037 4:134295276-134295298 GGTTTGCCTGTATTTTGTTGAGG - Intergenic
981892910 4:149760096-149760118 GAGAAGTCTAGATTTTGTTAGGG + Intergenic
982551110 4:156800965-156800987 GAGAAGCCTGAACTTTGTTAAGG + Intronic
985415984 4:189735972-189735994 GGGAAGCTTGGAGTGTGGTGAGG - Intergenic
985415991 4:189736007-189736029 GGGAAGCTTGGAGTGTGGTGAGG - Intergenic
985908908 5:2863937-2863959 GGGAGGCCTGGATGATGTCGGGG - Intergenic
986855478 5:11864143-11864165 TGGAAGCCTGCCTTTCGTTGTGG - Intronic
987450687 5:18080186-18080208 GGGAAGCCAGGATTTCAATGTGG - Intergenic
988879521 5:35486041-35486063 GAGAAGCCTGAATTTTGCTAAGG + Intergenic
990904446 5:60788817-60788839 GGAAAGTCTGAATTTTCTTGTGG - Intronic
991131373 5:63126038-63126060 GGGATGACTGCATTTTGTGGGGG + Intergenic
993616811 5:90122895-90122917 GGGTACCCTGGATTTTGTGCTGG - Intergenic
994093216 5:95826561-95826583 GGGAAATCTGGATTTTGTCCTGG - Intergenic
996764661 5:127023803-127023825 GGGAAGCTTGACATTTGTTGAGG - Intronic
998921255 5:147070772-147070794 GCAAAGCCGAGATTTTGTTGTGG + Intronic
1000253356 5:159515679-159515701 GGAAAGAGAGGATTTTGTTGAGG + Intergenic
1002016177 5:176324757-176324779 GGTGAGTCTTGATTTTGTTGGGG + Exonic
1002981349 6:2141834-2141856 GGGAAGTCTGGGTTTGGTTTTGG + Intronic
1003200334 6:3954207-3954229 GGTTTGCCTGCATTTTGTTGAGG + Intergenic
1004424742 6:15499666-15499688 GTGAGACCTGGAGTTTGTTGTGG + Intronic
1005320175 6:24645935-24645957 AGGAAGCGAGGATTTTGCTGGGG - Exonic
1009672178 6:66770145-66770167 GGTAGGTCTGAATTTTGTTGGGG + Intergenic
1012872165 6:104685214-104685236 GGGTAGGCTGGATTATGCTGTGG - Intergenic
1014210737 6:118705481-118705503 GGGAGGGCTGGATTTGGTTCCGG - Intronic
1015810960 6:137161991-137162013 GGGAAGCTCGTTTTTTGTTGGGG + Intronic
1016371082 6:143374949-143374971 GAGAAGGCAGAATTTTGTTGGGG + Intergenic
1018430710 6:163719515-163719537 GGGAAGCCTAGCCTTTGGTGAGG + Intergenic
1018746101 6:166763598-166763620 GGGAACCTTGGATTTCCTTGGGG + Intronic
1019460392 7:1155397-1155419 GGGAAGCCTGGTTTTTCCTTGGG - Intronic
1019995694 7:4723059-4723081 GGGAAGACGGGTTTTTGTTCGGG - Intronic
1022858183 7:34338034-34338056 GGAAAGCCTGGATTTTTTCAGGG + Intergenic
1023540059 7:41255320-41255342 GGCAAGCCTGAAATTTGTAGGGG - Intergenic
1023653421 7:42394319-42394341 GATAAGCCTGGATTATCTTGAGG + Intergenic
1026898249 7:74022840-74022862 AAGATGCCTGGATTTTGGTGGGG + Intergenic
1031188321 7:118512429-118512451 AGGATGCCTGGATTCTGGTGAGG - Intergenic
1032358713 7:131234541-131234563 GGGAAGCCTGTCTTTTCTGGTGG + Intronic
1034937082 7:155207133-155207155 GGTGCTCCTGGATTTTGTTGGGG + Intergenic
1036546703 8:9777694-9777716 GGGAAGCATGTATTTTTTGGAGG - Exonic
1037474594 8:19244275-19244297 GGGAAGCCTGAATTCTCATGGGG - Intergenic
1038065572 8:23960158-23960180 GTGAAGCTTGTATTTTGTTGTGG + Intergenic
1039210646 8:35209330-35209352 GGGAAGTCTAGATTTAGTTTAGG + Intergenic
1039241178 8:35558605-35558627 GTGATGCCTGGATTTGGCTGAGG - Intronic
1039550528 8:38439967-38439989 AGGATGCCTGGATTTTGTTGGGG - Intronic
1039666809 8:39542693-39542715 GGGAATTCTGGATTTTATGGAGG + Intergenic
1040639927 8:49321303-49321325 GAGAAGCATGGTTTGTGTTGAGG + Intergenic
1042356844 8:67837469-67837491 GGGAAGCCTGGATTCAGGTATGG - Intergenic
1042489849 8:69384791-69384813 GGTTTGCCTGTATTTTGTTGAGG - Intergenic
1042666767 8:71215685-71215707 GGGAAGCCTGGCTGCAGTTGAGG - Exonic
1043370076 8:79581144-79581166 GGAAAGACTGTTTTTTGTTGTGG - Intergenic
1044127655 8:88477942-88477964 GGTTTGCCTGTATTTTGTTGAGG - Intergenic
1045031436 8:98140199-98140221 GGGAAGACTGGGTTGTGTTGGGG + Intronic
1045244849 8:100434000-100434022 GGGAAGCCTTTATTTTTATGGGG + Intergenic
1045985749 8:108248199-108248221 GGGAAGCCTGGGCTTGGCTGTGG - Intronic
1047715606 8:127592271-127592293 GGGAAGCTGGGAATTTGTGGGGG - Intergenic
1048963768 8:139600438-139600460 AGGAGGCCTGGATGTTGCTGTGG - Intergenic
1049962573 9:750684-750706 TGGAAGACTGGATTTTTCTGGGG - Intergenic
1050890741 9:10821056-10821078 GGGACTACTGTATTTTGTTGGGG + Intergenic
1052730952 9:32284943-32284965 AAGAAGCCTGGATTTTATTAAGG + Intergenic
1053142764 9:35691239-35691261 GGGAGGCCTGGATTTTGCAGTGG + Intergenic
1056080100 9:83083722-83083744 GGGAACCCTGGATTTTCTTCTGG + Intergenic
1056224759 9:84483922-84483944 TGGAAGGCTGTCTTTTGTTGTGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057339056 9:94182945-94182967 GGAGAACCTTGATTTTGTTGAGG + Intergenic
1057522985 9:95774937-95774959 GGAAAGCTGGGACTTTGTTGAGG + Intergenic
1058734188 9:107878916-107878938 GGGAAGCCTGGATTCTTTTTTGG + Intergenic
1058992750 9:110270217-110270239 AAGAAGACTGGATTTTGGTGGGG + Intergenic
1060307649 9:122430612-122430634 GAGTAGTCTGGACTTTGTTGTGG + Intergenic
1060559110 9:124528224-124528246 GGAAAGCCTGGCTCTGGTTGGGG + Intronic
1061385216 9:130285594-130285616 GGGTTGCCTGGACTTTGATGGGG - Intronic
1061728923 9:132598160-132598182 GGGATGAATGGGTTTTGTTGAGG - Intronic
1186801803 X:13100124-13100146 TGGATGCCTGGATTTTATAGAGG - Intergenic
1188113819 X:26221040-26221062 GGGAGGGCTAGATTTTGGTGGGG + Intergenic
1190714625 X:53093247-53093269 TGGAAGCCTGGGTTTTATTCTGG + Intergenic
1191077013 X:56465470-56465492 AGGTAGCCAGTATTTTGTTGAGG + Intergenic
1195388390 X:104335153-104335175 GGGAGGCTGGGATTTTGTGGAGG + Intergenic
1195753335 X:108178312-108178334 GGGCAGCCTGCTTTTGGTTGGGG - Intronic
1198088872 X:133307982-133308004 GGGAAGCTGGGCCTTTGTTGGGG + Intronic
1198925357 X:141785762-141785784 GGTATGCCAGTATTTTGTTGAGG + Intergenic
1198935643 X:141900611-141900633 TGCAAGCCAGGATTTTCTTGTGG - Intergenic
1199003577 X:142670345-142670367 GGCAAGCCTGGGTGTTGTTATGG - Intergenic
1200066565 X:153506864-153506886 CGATGGCCTGGATTTTGTTGTGG - Exonic
1200085448 X:153602129-153602151 GGCAGGCCTGGACTTTGATGAGG - Intergenic
1200961746 Y:9002188-9002210 GAGATGCCTGGTTTTTGGTGTGG - Intergenic
1201067251 Y:10109356-10109378 GGGTTGCCAGTATTTTGTTGAGG + Intergenic
1202116979 Y:21477579-21477601 GGGAAGCCTGGGTCTTGGGGAGG - Intergenic