ID: 1107462401

View in Genome Browser
Species Human (GRCh38)
Location 13:40616739-40616761
Sequence CAAGGGGTGTGGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 954
Summary {0: 1, 1: 0, 2: 6, 3: 81, 4: 866}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107462401 Original CRISPR CAAGGGGTGTGGAGGGAAGA AGG Intronic
900021113 1:187301-187323 TATGGGGTGTCTAGGGAAGAAGG + Intergenic
900366378 1:2313520-2313542 CCAGGGGTGTGGAGGGTCGAGGG + Intergenic
900385323 1:2407955-2407977 CAACGGCTGTGGAGGGGAGAAGG + Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900462033 1:2806149-2806171 CAAGGTCTGTTGAAGGAAGAAGG - Intergenic
900476322 1:2878042-2878064 CAAGGGTTGTTGAGTGACGAGGG - Intergenic
900691246 1:3981948-3981970 CAAGGGGTGTGTGGGCAGGAGGG + Intergenic
900881849 1:5388021-5388043 CCAGGGGTGTCACGGGAAGAAGG - Intergenic
901445801 1:9307399-9307421 CAGGGGCTGGGGAGGGAGGATGG - Intronic
901519079 1:9768958-9768980 AAAGGGGGAAGGAGGGAAGAAGG + Intronic
901901411 1:12366480-12366502 GAAGGAGTGGGGAGGGAAAAGGG + Intronic
902121455 1:14169491-14169513 CAACTGGAGTGGAGTGAAGAGGG + Intergenic
902399778 1:16151557-16151579 CCAGGGTGGAGGAGGGAAGAGGG + Intronic
902546019 1:17190786-17190808 CAAGGGGTGTGCTGGACAGAGGG + Intergenic
902793265 1:18783624-18783646 CAAAGGGTGGAGAGGGAGGAGGG + Intergenic
903178311 1:21593311-21593333 CAAGGCGGGAGCAGGGAAGAAGG + Intergenic
903226630 1:21897445-21897467 GTAGGGGTGGGGAGGGAAGGGGG - Intronic
903321866 1:22548167-22548189 AGAGGGGTGTGGAAGGGAGAGGG - Intergenic
903632452 1:24786430-24786452 ACAGGGGTGTGAAGGGAAGAGGG + Intronic
903657222 1:24956799-24956821 AAAGGGGTGGGGAGGAAAGGAGG - Intronic
903667737 1:25018178-25018200 CTAGGGGTGGGGTGAGAAGAGGG - Intergenic
903708795 1:25306532-25306554 AAAGGGGTGGGTAGGGAATATGG + Intronic
903718320 1:25385886-25385908 AAAGGGGTGGGTAGGGAATATGG - Intronic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
904320929 1:29697465-29697487 CTCGGGGTGTGCAGGGTAGATGG - Intergenic
904322766 1:29707722-29707744 CAAATGGTGGGGAGGGGAGAAGG - Intergenic
904405552 1:30285954-30285976 CAAGAGGCCAGGAGGGAAGACGG + Intergenic
904878104 1:33671994-33672016 AAAGGGGGGTGGAGCCAAGATGG + Intronic
905186873 1:36203396-36203418 CGAGGTGTGTGGTAGGAAGAGGG + Intergenic
905256556 1:36688787-36688809 GAAGGGGTGTGGAGAGGGGAAGG + Intergenic
905269638 1:36778989-36779011 GAAGGGGAGGGGAGGGAAGGGGG + Intergenic
905375007 1:37514389-37514411 GAGGGGGCGTGGAGGGAGGACGG - Intronic
905508127 1:38496327-38496349 CCTGGGCTGCGGAGGGAAGAAGG + Intergenic
906025275 1:42668312-42668334 AAATGGGTGAGGAGGCAAGAAGG - Intronic
906143648 1:43547712-43547734 TGAGGGGAGTGGAGGGAAGCGGG + Intronic
906237746 1:44222033-44222055 CAAGGCGGGTGGCGGGAAGACGG - Intronic
906326594 1:44850041-44850063 CAGGGGTGGTGGAGGGAAGGTGG + Intergenic
906346034 1:45014937-45014959 CAGGGAGTGTGTGGGGAAGACGG + Exonic
906497596 1:46316442-46316464 GAAGGGGAGTGGTGAGAAGAGGG + Intronic
906627827 1:47340009-47340031 GAAGGGGAGGGGAGGGAAGAGGG - Intronic
907016147 1:51014991-51015013 CAAGGGGGGAGGGAGGAAGAGGG + Intergenic
907074501 1:51566179-51566201 AAAGAGGCATGGAGGGAAGAGGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907546160 1:55261647-55261669 CATGGGGTGGGTAGGGGAGAGGG + Intergenic
907757973 1:57329278-57329300 CATGGGCTTTGGAGGGAGGAAGG - Intronic
907918963 1:58895547-58895569 AAAGGGCTGGGAAGGGAAGAGGG + Intergenic
908212233 1:61912678-61912700 GGAGGGGAGGGGAGGGAAGAGGG + Intronic
908817549 1:68049969-68049991 GAAGGAGTGTGGAGGGGAGTGGG - Intronic
909412416 1:75370557-75370579 CAAAGGCTGTAGAGAGAAGATGG + Intronic
909867425 1:80690964-80690986 CAGGTGGTTAGGAGGGAAGAAGG + Intergenic
909909439 1:81243983-81244005 CAAGGTGTGTGTAGGGAAACAGG - Intergenic
909953974 1:81754464-81754486 AAAGGGGAGGGGAGGGGAGAAGG - Intronic
909981478 1:82107022-82107044 GAAAAGGTGGGGAGGGAAGAAGG + Intergenic
910097362 1:83538838-83538860 CCAGGGGTAAGGAGGGAGGAAGG + Intergenic
911267880 1:95764294-95764316 GAAGGGGTGGGGAGGGGAGGTGG + Intergenic
911323742 1:96444964-96444986 CAAGAGATGTGGAAGGAGGAAGG + Intergenic
912451679 1:109771012-109771034 CCACGGGTATGGAGGGGAGAGGG + Intronic
912566159 1:110589009-110589031 GGAGGGGTGTGGAGGGAGGTGGG + Intergenic
912576372 1:110675349-110675371 CTAGGGGTGTGGAGGCCAGGGGG - Intergenic
913212537 1:116593584-116593606 CAAGGGGTGTTAAGGACAGAGGG - Intronic
915249779 1:154579754-154579776 CAAGGGCAGTGTGGGGAAGATGG - Exonic
915357149 1:155262175-155262197 GCAGGGGCGTGGAGGGCAGAGGG - Exonic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915604588 1:156942555-156942577 CAAGGGGTTGGGAAGGAAGTGGG - Intronic
915738967 1:158103567-158103589 CAAGGGGTATGGAAAGAACAAGG + Intergenic
915924438 1:160005133-160005155 CATGGGGTGGGATGGGAAGATGG - Intergenic
916075442 1:161197722-161197744 GAAGGGGTGGGGTGGGGAGAGGG + Intronic
917192216 1:172430016-172430038 GAAGGGGTGTAGAGGGAGAAGGG + Intronic
917748586 1:178034702-178034724 CACCAGGTGTGAAGGGAAGATGG + Intergenic
917905132 1:179580789-179580811 GAAGGGGTGGAGAGGGAAGAGGG + Intergenic
918331391 1:183464233-183464255 AGAGGGGAGGGGAGGGAAGAGGG + Intergenic
918543543 1:185657619-185657641 AGAGGGGTGGGGAGGGGAGAAGG - Intergenic
918612068 1:186504225-186504247 CAAGGGCAGTGGAGGGAGGAGGG + Intergenic
918662188 1:187103333-187103355 AAAGGGGTCTGGATGGGAGAGGG - Intergenic
918733119 1:188022996-188023018 GAAGGGGAGGGGAGGGGAGAAGG + Intergenic
918738452 1:188096876-188096898 CTAGGGGTGGGGAGGGTAGGTGG - Intergenic
919690183 1:200522164-200522186 CAAGGGGTGTTCAGGAAAAAGGG + Intergenic
920050586 1:203162371-203162393 TGAGGGGTGAGGAGAGAAGAGGG + Intronic
920059126 1:203215547-203215569 AAAGGGCTGAGAAGGGAAGAGGG + Intronic
920939112 1:210464392-210464414 GAAGGGGTGTGGGGAGAAGCGGG + Intronic
921122993 1:212152904-212152926 AATAGGGTGTGGAGGGCAGAAGG + Intergenic
921976950 1:221213332-221213354 AAAGGAGTCAGGAGGGAAGAAGG - Intergenic
922225205 1:223640099-223640121 CAAGGGGTGGGGAGAGAGGGTGG - Intronic
922691214 1:227693110-227693132 GAAGGGGACTGGAGGCAAGAGGG - Intergenic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
922920814 1:229301308-229301330 CAAGGAGAGGGCAGGGAAGAAGG + Intronic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924123187 1:240823526-240823548 CAAGGGGTGGGGTGGGGACATGG + Intronic
924280798 1:242435025-242435047 CAAGGGCTGGGGAGTGAGGAGGG - Intronic
924297684 1:242604781-242604803 AAATGGGGGTGGATGGAAGAGGG + Intergenic
924775499 1:247112421-247112443 CAAGGGGGCTGGCGGGAGGACGG + Intergenic
924856307 1:247878562-247878584 CAAGGTCTGTGTAGGGAAGGTGG + Intergenic
1062904023 10:1167500-1167522 CACGCGGTGTGGTGGGAAAACGG - Intergenic
1063202848 10:3801598-3801620 CAAGGGCTCTGGGGGAAAGATGG + Intergenic
1063223430 10:3992498-3992520 GAAGGGGAGGGGAGGGGAGAAGG - Intergenic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064804341 10:19113553-19113575 CAAGGGAGGTGGAGGAAGGAGGG - Intronic
1065130251 10:22613080-22613102 CAATGGGAGTGAAGGGAAAAGGG + Intronic
1065459851 10:25947997-25948019 CAAGGAGTTGGGAGGCAAGATGG + Intronic
1065845359 10:29738542-29738564 CAAGTGCTGTGAAGGGAAGCTGG + Intergenic
1066555481 10:36608164-36608186 CCAGGGGTGTGTGGGGAAGGAGG - Intergenic
1066569380 10:36754354-36754376 GAAGGGGAGGGGAGGGGAGAGGG + Intergenic
1067345861 10:45438876-45438898 CAAGGAGGGGGGAGGGAGGAGGG - Intronic
1067361008 10:45578461-45578483 AATGGGATGTGGAGGGAGGAGGG + Intronic
1067452205 10:46388688-46388710 CAAGGGGAATGGGGGGCAGAGGG + Intronic
1067585032 10:47471067-47471089 CAAGGGGAATGGGGGGCAGAGGG - Intronic
1069567190 10:69471591-69471613 GGAGGGGAGGGGAGGGAAGAGGG - Intronic
1069801588 10:71085065-71085087 GAAGGGGTGGGGAGGGATGCTGG + Intergenic
1069824079 10:71244661-71244683 CAAGAGGAGAGGAGGGAGGAGGG + Intronic
1070543292 10:77432856-77432878 GAAGGGGCAGGGAGGGAAGAAGG + Intronic
1071026196 10:81116605-81116627 CCAGGAGTGGAGAGGGAAGAGGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071726649 10:88204909-88204931 AAAGGGGTGTTGGGGGAAGTCGG + Intergenic
1071815568 10:89229314-89229336 CCAGGGGTTAGGAGGGAGGAAGG + Intronic
1072071934 10:91926430-91926452 CATGGGGTGTGGGAGGAAAAGGG - Intronic
1072114529 10:92357508-92357530 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1072625636 10:97109563-97109585 AATGGGGTGAAGAGGGAAGATGG - Intronic
1073070921 10:100792736-100792758 AAAGATGTGTGGAGGGAAGAGGG - Intronic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073541296 10:104317958-104317980 CAAGGGTTGGGGAGTGGAGAAGG + Intronic
1073857803 10:107697518-107697540 GAAGGGGAGGGGAGGGAAGGGGG - Intergenic
1073937627 10:108652858-108652880 GGAGGGGAGGGGAGGGAAGAAGG + Intergenic
1074311649 10:112327788-112327810 AAAAGGGGGAGGAGGGAAGAGGG + Intergenic
1074794851 10:116932468-116932490 CATGGACTGGGGAGGGAAGAGGG - Intronic
1074874012 10:117600435-117600457 AAAGGGGTGTAATGGGAAGAGGG + Intergenic
1075312312 10:121424708-121424730 GAAGGAGGGTAGAGGGAAGAGGG + Intergenic
1075702301 10:124477522-124477544 AAAGGGGTGTGGAGGCAGCAGGG - Intronic
1075922748 10:126226420-126226442 CAAGGGGTGTGAAGGCAACATGG + Intronic
1076639630 10:131905517-131905539 CAAGGGCTGGGGTGGGAAGGGGG - Intronic
1076725515 10:132411181-132411203 CCAGGTCTGTGGAGGCAAGAGGG - Intronic
1077394532 11:2314651-2314673 CAAGGGGTGGGGTGGGAGGATGG - Intronic
1078302580 11:10147564-10147586 TAAGGGTGGAGGAGGGAAGAAGG + Intronic
1078642375 11:13108638-13108660 CAGGGCTTGTGGAGGGAAGAGGG + Intergenic
1078859158 11:15231245-15231267 GAAGTGGTGTGGAGGGAAGAGGG + Intronic
1079361225 11:19771963-19771985 CAAGGCTGGTGGAGGGGAGACGG + Intronic
1080317292 11:30964790-30964812 CAAGTGGGGAGGATGGAAGAGGG + Intronic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1080666046 11:34337257-34337279 CAGGGGCTGTGTAGGGAAGGAGG + Intronic
1081457973 11:43243996-43244018 AAAGGTGTGGGGAGGGAAGTTGG - Intergenic
1081808289 11:45901676-45901698 CAATGTGTGTGGTGGCAAGAGGG - Intronic
1081864675 11:46352948-46352970 CAGGGGGTGAAGAGGAAAGATGG - Intronic
1082175616 11:49055668-49055690 CAGGGGGTGTGATGGGCAGAGGG - Intronic
1082636335 11:55598586-55598608 CACGGGGGGTGGAGCCAAGATGG - Intergenic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083250563 11:61464076-61464098 GAAGGGGAGGGAAGGGAAGAGGG - Intronic
1083344189 11:61978106-61978128 CAAGGGGTGGGGGAGGGAGATGG - Intergenic
1083610689 11:64002844-64002866 CTTGGGGTGGGGTGGGAAGAGGG - Intronic
1083610782 11:64003177-64003199 AGAGGAGGGTGGAGGGAAGAAGG - Intronic
1084019233 11:66407901-66407923 CAAGGGGTGTGGAAGTGAAAGGG + Intergenic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1084596123 11:70118057-70118079 AGAGGGGTGCGGAGGGATGAAGG - Intronic
1084949727 11:72657967-72657989 GAGGAGGGGTGGAGGGAAGAGGG + Intronic
1085109781 11:73877180-73877202 CGAGGGATATGGAGGGAACAGGG + Intronic
1085351006 11:75797811-75797833 CAAGGGTGGGGGAGGGTAGAGGG + Intronic
1086575846 11:88338075-88338097 GAAAGGGTGTGGGGGGAATAAGG + Intergenic
1086690131 11:89780401-89780423 CAAGGGGTGTGATGGGCAGAGGG + Intergenic
1086698531 11:89872571-89872593 CAAGGGGTGTGATGGGCAGAGGG - Intronic
1086707635 11:89971925-89971947 CAAGGGGTGTGATGGGCAGAGGG + Intronic
1086715723 11:90059556-90059578 CAAGGGGTGTGATGGGCAGAGGG - Intergenic
1087006665 11:93478384-93478406 AAAGGGAAGGGGAGGGAAGAGGG + Intergenic
1087054457 11:93919992-93920014 CATGGGGAGTGGTGGGAGGATGG + Intergenic
1087149766 11:94848538-94848560 CAAGGGTTGTGCAGTCAAGAAGG + Intronic
1087474820 11:98622110-98622132 GAAGGGGAGGGGAGGGAAGGGGG - Intergenic
1087624373 11:100580243-100580265 TTAAGGGTGTGTAGGGAAGAAGG - Intergenic
1088920095 11:114254464-114254486 CAATTGCTGTGGATGGAAGAGGG + Intergenic
1088944908 11:114501736-114501758 GAAGGGCTTTGGAGGTAAGAAGG + Intergenic
1089078560 11:115758688-115758710 CGAGGGGAGTGGAGGCAAGGAGG + Intergenic
1089157489 11:116413672-116413694 AGAGGGGAGGGGAGGGAAGAGGG + Intergenic
1089337723 11:117736510-117736532 CAAGAGGTGTGGACCCAAGAGGG + Intronic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1090378694 11:126309869-126309891 GAAGGGGTTGGGAAGGAAGATGG - Intronic
1091349702 11:134883093-134883115 CAGGGGATGTGAAGGGAAGTCGG + Intergenic
1091666747 12:2424353-2424375 CAAGGGGGAGGGAGGGAAAACGG + Intronic
1091957495 12:4659522-4659544 CAAGGGGTGAGAAAGAAAGATGG - Intronic
1092254230 12:6917458-6917480 GCAGGGGTGGGGAGGGAGGAGGG + Intronic
1092744371 12:11659826-11659848 TAAGAGGTGAGGAAGGAAGAGGG + Intronic
1092751809 12:11726219-11726241 CAAGGGGTATGTTTGGAAGAAGG + Intronic
1092933063 12:13335606-13335628 CAAGTGGTGAGCAGAGAAGAAGG + Intergenic
1093629773 12:21395006-21395028 CAAGGGGAGAGGAGCCAAGATGG + Exonic
1093750996 12:22800123-22800145 CAAGGGTTTGGGAGGGGAGAGGG - Intergenic
1093926297 12:24911693-24911715 CGAGGGGTGGGGAGGGAAGAGGG - Intronic
1094168605 12:27467340-27467362 CATGGGGTGTAGGGAGAAGAAGG + Intronic
1094646289 12:32327874-32327896 CAAGGAGAGTGGTGAGAAGATGG + Exonic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1095960386 12:47830767-47830789 GAAGGGGAGGGCAGGGAAGATGG + Intronic
1096230287 12:49893030-49893052 GTAGTGGGGTGGAGGGAAGAGGG - Intronic
1096489333 12:52005248-52005270 CAAGAGGTGTGGGTGGAAGAGGG - Intergenic
1096522954 12:52194426-52194448 GACGGGGTGAGGAGGGGAGAGGG - Intergenic
1096551379 12:52375569-52375591 CAAGGGTTGTGGAGGGGGGAGGG - Intergenic
1096674718 12:53220239-53220261 TAAGGGGTGGGCGGGGAAGAGGG + Intronic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1096968404 12:55646850-55646872 CCAGGGGAGTTGAGGGAAAATGG + Intergenic
1097054127 12:56239890-56239912 ATAGGGGTGAGGAAGGAAGAGGG + Exonic
1097644588 12:62221172-62221194 GAAGGGGAGGGGAGGGGAGAAGG + Intronic
1097962674 12:65547744-65547766 TAAGGGGTGGGGAGGGAGGCAGG - Intergenic
1098038688 12:66333232-66333254 CAGGGGGTGTGGTGGGCAGGAGG + Intronic
1098484517 12:71005252-71005274 CATGGGGTGGGGAGGAAATAGGG - Intergenic
1098719831 12:73882304-73882326 AAAGAAGTGTGGAGGAAAGAGGG - Intergenic
1100677393 12:96882132-96882154 GTAGGGGTTTGGAGAGAAGAGGG + Intergenic
1100772926 12:97943177-97943199 CAAAGGAAGTGGAGGGAAGCTGG + Intergenic
1101345039 12:103878964-103878986 CAAGGGGTAAGCAGGGGAGAAGG - Intergenic
1101345335 12:103880941-103880963 GCAGGGGAGTGGAGGGAAGGGGG - Intergenic
1101673348 12:106896709-106896731 GAAGGGGAGGGGAGGGAGGAGGG + Intergenic
1101673364 12:106896740-106896762 GAAGGGGAGGGGAGGGAGGAGGG + Intergenic
1101843168 12:108342162-108342184 CAAGGGGAGGAGAGGGGAGAGGG + Intergenic
1101959135 12:109235082-109235104 CTAGGGCTGTGGTGGGGAGAGGG - Intronic
1102126180 12:110482992-110483014 AAGGGAGTGTGCAGGGAAGAGGG + Intronic
1102650508 12:114439059-114439081 AAAGGGCGGAGGAGGGAAGAAGG + Intergenic
1102921453 12:116794629-116794651 GAAGGGGAGGGGAGGGGAGAAGG + Intronic
1103153643 12:118664012-118664034 CATGGGGTGTGGAGCCAAGATGG - Intergenic
1103738850 12:123078088-123078110 GAAGGGGTGGGGAGCGGAGAGGG + Intronic
1103747138 12:123132674-123132696 CAGGGGTTGGGGAGGGGAGATGG - Intronic
1103859481 12:124000824-124000846 CAAAGGGTGAAAAGGGAAGAGGG - Intronic
1104166757 12:126238998-126239020 AAAGGGCTGTGGTGGGAAGTGGG - Intergenic
1104323581 12:127774625-127774647 CCTGGCGTGTGGAGGGAAGACGG - Intergenic
1104623333 12:130334513-130334535 CCAGGGTAGTGGGGGGAAGAGGG + Intergenic
1104750234 12:131233695-131233717 CAAGGAGAGTGAAGGGCAGAGGG + Intergenic
1104782480 12:131430766-131430788 CAAGGAGAGTGAAGGGCAGAGGG - Intergenic
1104850636 12:131871906-131871928 CAGGGGATGGGGAGGAAAGAAGG + Intergenic
1104925478 12:132311816-132311838 CAGGGAGTGTGGAGGGTGGAGGG + Intronic
1105215781 13:18284207-18284229 CAAGGGGTGTTAAGGACAGAGGG - Intergenic
1105440508 13:20411793-20411815 TAAGAGGAGTGAAGGGAAGAGGG - Intronic
1105644890 13:22306531-22306553 CAACAGATGTAGAGGGAAGATGG - Intergenic
1105759306 13:23498754-23498776 AAAGGGGTGAGGTGGGCAGAAGG + Intergenic
1105829004 13:24147750-24147772 CTAGGGGTGTGGAGGGAACGGGG - Intronic
1105886857 13:24649827-24649849 GAAGGGGGGAGGAGGGGAGAAGG - Intergenic
1105896021 13:24718086-24718108 AAAGGGGGGTGGAGGGAGGGAGG + Intergenic
1105978361 13:25493807-25493829 AAAGGAGTGTGGAGGGGAGGTGG + Intronic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1106840854 13:33683652-33683674 CCTGGGGTGGGGAGGGGAGAAGG + Intergenic
1107139614 13:36983813-36983835 CAAGGGATGGGGATGGATGATGG + Intronic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1107634310 13:42377015-42377037 CAAAGGGGGTGGGGGGAGGAAGG - Intergenic
1108004480 13:45933369-45933391 CCAGGGCTGGGGTGGGAAGATGG + Intergenic
1110886388 13:80642374-80642396 CAAGTTGTGTGCATGGAAGAGGG - Intergenic
1111006347 13:82254846-82254868 CGGGAGGTGTGGAGGGAGGAAGG + Intergenic
1112089994 13:96072977-96072999 ACAAGGGTGTGGAGGTAAGAAGG - Intergenic
1112191679 13:97184473-97184495 CCAGGGGTGAGGGGGGAACACGG - Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113931464 13:113971179-113971201 AAGGGGGTGTTGTGGGAAGAGGG - Intergenic
1114062329 14:19029472-19029494 CAGGGGGTGTTGTGGGAAGGTGG - Intergenic
1114099930 14:19370521-19370543 CAGGGGGTGTTGTGGGAAGGTGG + Intergenic
1114345815 14:21793678-21793700 CATCAGGTGTGGAGGGTAGATGG + Intergenic
1114553987 14:23551112-23551134 ACAGGGGTGTGGGAGGAAGAGGG - Intronic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1115205253 14:30896580-30896602 GGAGGGGAGGGGAGGGAAGAAGG + Intronic
1115465069 14:33706262-33706284 CAAGTGGTGGAGAGGGAGGATGG + Intronic
1116149536 14:41121978-41122000 CAAGGAATGTGAAGTGAAGAGGG + Intergenic
1116486357 14:45453358-45453380 TCAGGGGTGAGGAGGGATGAAGG + Intergenic
1116810227 14:49532820-49532842 GAAGGGTAGTGGAGGGCAGAGGG + Intergenic
1117049224 14:51843931-51843953 CAAGGGGTGGGGAGGAGAAAGGG - Intronic
1117947722 14:61047320-61047342 AAAGGGATGTGGAGGAAGGATGG + Intronic
1118305254 14:64650013-64650035 CAAGGGATGAGGTGGGAAGGGGG + Intergenic
1118354079 14:64997357-64997379 ATAGGGATGTGGAAGGAAGATGG - Intronic
1118366446 14:65101696-65101718 CAAGGGGTGGGGAGGGAGGAAGG - Intronic
1118470953 14:66074944-66074966 GAAGGGATGGGGAGGGAGGAAGG - Intergenic
1118537468 14:66783659-66783681 CAAGGGTTGGGGAGAGTAGATGG - Intronic
1118774087 14:68962529-68962551 GCTGGGGTGTGGAGGGAGGAGGG - Intronic
1118867976 14:69718222-69718244 CAAGGCCTGTGGAGAAAAGAAGG - Intergenic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119375487 14:74188539-74188561 AAACGGGGGTGGAGGGAGGAGGG - Intronic
1119482271 14:74965455-74965477 CAAGGGGTGCAGAGGGGAGCCGG + Intergenic
1119660253 14:76446030-76446052 CAATGGCGGGGGAGGGAAGAGGG + Intronic
1119664323 14:76473693-76473715 GGAGGGAGGTGGAGGGAAGAAGG + Intronic
1119847437 14:77840895-77840917 GGAGGGGAGGGGAGGGAAGAGGG + Intronic
1119949987 14:78735100-78735122 CCAGGGATGTGAAGGGAAGTCGG + Intronic
1120056775 14:79933597-79933619 CAAGGGGTGGAGAGTGCAGAGGG + Intergenic
1120704995 14:87736547-87736569 CAGGGGGTGTGGTGGGGGGAAGG - Intergenic
1121623183 14:95364415-95364437 CCTGGGGTGTGGGGGGAGGAGGG + Intergenic
1122038531 14:98965422-98965444 AAAGGGGTGAGGAGGGAGAAGGG - Intergenic
1122137734 14:99644682-99644704 GTAGGGGTGGGGAGGGAGGACGG - Intergenic
1122316498 14:100828523-100828545 GGAGGGGTATGGAGGGAGGAAGG - Intergenic
1122840758 14:104461595-104461617 CAAGGGGGGTGGACGGGGGACGG + Intergenic
1122907521 14:104808578-104808600 GAAGGGGTGTTGAGGGAAAGTGG - Intergenic
1123587515 15:21772856-21772878 GAAGGGGTGTTGGGGAAAGAGGG + Intergenic
1123624153 15:22215421-22215443 GAAGGGGTGTTGGGGAAAGAGGG + Intergenic
1123683028 15:22776023-22776045 CATGGGGTGGGGAGGGAGGTGGG + Intronic
1123763059 15:23447146-23447168 CATGGGGTGGGGAGGGAGGTGGG + Exonic
1123778418 15:23602784-23602806 CATGGGGTGTGGAGGTCAGTGGG - Intronic
1124029055 15:25992603-25992625 CATGGGCTGTGGAGGGTAGAGGG - Intergenic
1124358541 15:29017168-29017190 GAAGGGCTGTGGTGGGAAGAGGG + Intronic
1124694442 15:31852219-31852241 CAAGTGGTGTGAAAGGGAGAGGG - Intronic
1125202083 15:37108955-37108977 TATGGGGTGTGGAGGGGAAAGGG + Intergenic
1125281231 15:38044351-38044373 GTAGGGGAGGGGAGGGAAGAAGG + Intergenic
1125281244 15:38044378-38044400 GGAGGGGAGGGGAGGGAAGAAGG + Intergenic
1125664347 15:41417781-41417803 CAAGGGATGTGGACAGAGGAAGG + Intronic
1125926070 15:43564269-43564291 CAAGGGATGGGGAGGGGAGCAGG - Intronic
1125939214 15:43663820-43663842 CAAGGGATGGGGAGGGGAGCAGG - Intronic
1125971030 15:43911975-43911997 CAAGCGCTGAGGAGAGAAGATGG - Intronic
1126148891 15:45504034-45504056 CAAATGGTCTGGAGTGAAGAAGG - Intronic
1126167656 15:45667106-45667128 GAAGGGGAGGGGAGGGAGGAAGG - Intronic
1126426226 15:48529462-48529484 GAAAGAGTGTGGAGGGCAGATGG + Intronic
1126581109 15:50243337-50243359 CAACGGCTGTGACGGGAAGATGG - Intronic
1126721938 15:51590943-51590965 CAAGGGGGGTGGAGCCAAGATGG + Intronic
1127172505 15:56317159-56317181 CAAGGGGGGAGGAGCCAAGATGG - Intronic
1127657798 15:61071657-61071679 GGAGGGGTGGGGAGGGGAGAGGG + Intronic
1127790379 15:62392958-62392980 CAAGTGGTCTTGAGAGAAGAGGG + Intronic
1128119455 15:65134783-65134805 CAAGGGGTGGGGAGGGACCAAGG - Intergenic
1128327989 15:66737565-66737587 AATGGGGTGAGGAGGAAAGACGG - Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128546734 15:68573489-68573511 GAAGGGTTGTGGTGGGTAGAGGG + Intergenic
1128595213 15:68939604-68939626 GAAGGTGTGTGGAGAGAGGATGG + Intronic
1128611741 15:69079359-69079381 TGAGAGGTCTGGAGGGAAGAGGG + Intergenic
1128669442 15:69563448-69563470 TAAGGGGAGAGGAGGGAACAGGG + Intergenic
1128701949 15:69811135-69811157 GAAGGGGCCTGGAGGGAAGTGGG - Intergenic
1128761610 15:70219833-70219855 CAAGGGGTGTGGAATGAGCAGGG + Intergenic
1129036709 15:72654751-72654773 CATGGGGTGGGGAGGGAGGTAGG - Exonic
1129213178 15:74082474-74082496 CATGGGGTGGGGAGGGAGGTAGG + Exonic
1129225710 15:74169261-74169283 TCAGGGGAGGGGAGGGAAGAAGG + Intergenic
1129314115 15:74730926-74730948 CCAGGGGTGTGGAGAGGTGAGGG - Intergenic
1129397221 15:75258612-75258634 CATGGGGTGGGGAGGGAGGTAGG - Exonic
1129400833 15:75282889-75282911 CATGGGGTGGGGAGGGAGGTAGG - Exonic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129581664 15:76818598-76818620 TAAGGGGGGTGGAGCCAAGATGG + Intronic
1129652645 15:77502333-77502355 CAAGGTGTGTTTAGGGAACAAGG - Intergenic
1129687691 15:77695933-77695955 CAAGGGAGGAGGAGGGAAGGAGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130392733 15:83473290-83473312 CCAGGGGTGAGGAGGGGAGAGGG + Intronic
1130472219 15:84235848-84235870 CGCGGGGTGGGGAGGGAAGCGGG - Exonic
1130571321 15:85046704-85046726 CAAGGGATAGGGAGGGTAGAGGG + Intronic
1131090893 15:89624375-89624397 CAGGGGGAGTTGAGGGAACAGGG - Exonic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131187961 15:90291974-90291996 CATGGGGTGTGGAGGGAGGCGGG - Intronic
1131361181 15:91792068-91792090 CAAAGGGGATGGAGGGAGGAGGG - Intergenic
1131438511 15:92441358-92441380 AGAGGGGTGTGGAAGCAAGAAGG + Intronic
1131519605 15:93103669-93103691 TAAAGGGTGTGGAGGAAACAGGG + Intergenic
1131545669 15:93313690-93313712 AAAAGGGAGGGGAGGGAAGAGGG - Intergenic
1131838968 15:96416548-96416570 CAAGGGGCGGGGAGGGATGGAGG - Intergenic
1132229805 15:100173043-100173065 TAAGGGGTGGGGTGGGGAGATGG + Intronic
1132599093 16:765990-766012 CAGGAGGTGTGGGAGGAAGAAGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1132986997 16:2772431-2772453 CAAAGTGTGTGAAGGGAACAAGG - Intronic
1133149153 16:3813914-3813936 CATTTGGTGTGGAAGGAAGATGG - Intronic
1133813193 16:9177246-9177268 GGAGGGGAGAGGAGGGAAGAGGG - Intergenic
1134212473 16:12289304-12289326 CCAAGGGAGAGGAGGGAAGAAGG - Intronic
1134225113 16:12383858-12383880 GAAGGGTAGTGGAGGGAGGAGGG - Intronic
1134291744 16:12907154-12907176 GAAGGGGGATGGAGGGAAGGAGG - Intronic
1135110922 16:19690310-19690332 GAAGGAGTGGGGAGGGAAGGAGG + Intronic
1135414237 16:22256919-22256941 CAAGGGCTGTGGTGGGCAGAGGG - Intronic
1135552451 16:23408416-23408438 CAGGGGGTGAGCAGGGCAGAAGG + Intronic
1135603344 16:23801757-23801779 GGAGGGGAGGGGAGGGAAGACGG - Intergenic
1135667563 16:24348956-24348978 CTAGGGGTGAGGAGAGAGGAAGG - Intronic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136409696 16:30069108-30069130 CAAGGGCTGTTGAAGGCAGAGGG + Intronic
1137498418 16:48990395-48990417 GAAGGGGAAGGGAGGGAAGAAGG + Intergenic
1137534757 16:49311585-49311607 AAAGGGGGTTGGAGGGAAAAAGG - Intergenic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1137677521 16:50311103-50311125 CTAGTGGTGGGGAGGGAAGGAGG + Intronic
1138134025 16:54506294-54506316 GAAGGGGGGTGGAGGGGAGGTGG - Intergenic
1138464130 16:57174815-57174837 CAAGGGGTTTACAGGGAGGAAGG - Intronic
1138889564 16:61126153-61126175 CAAGGGGTTAGGAGGGAGGGAGG - Intergenic
1139482786 16:67239921-67239943 GAAGGGGAATGGAGAGAAGATGG + Intronic
1139591466 16:67935582-67935604 CCAGGGCTGTGAAGGGCAGACGG + Exonic
1139925368 16:70483015-70483037 GAAGGGGTGGGGAGAGGAGAGGG - Intronic
1139955662 16:70691822-70691844 CCAGCGGTGTGGAGGGCACAGGG + Intronic
1140150389 16:72357564-72357586 CATGGTGTGTGTAGGGAGGAGGG - Intergenic
1140868215 16:79082752-79082774 GAAGGGACGTGTAGGGAAGATGG + Intronic
1141717136 16:85733383-85733405 CAAGGGCTGGGGAGGGAACGGGG + Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142269168 16:89080169-89080191 GGAGGAGTGTGGTGGGAAGAGGG + Intergenic
1142766549 17:2067660-2067682 CATGGGGAGGGGAAGGAAGACGG + Intronic
1143582415 17:7834864-7834886 GCAGGGGGGTGGTGGGAAGAAGG - Intergenic
1143595547 17:7911665-7911687 CAAGGGGTGGGGAAGGTGGAGGG - Exonic
1143671369 17:8398136-8398158 ATAGGGGTGTGGGGGGAAGATGG - Intergenic
1143883097 17:10045287-10045309 CAAGGGCTGTGCTGGGCAGAGGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144080686 17:11761375-11761397 AAAGCGGGGTGGAGAGAAGAGGG + Intronic
1144379836 17:14683767-14683789 CAGGGAGTGAGGAAGGAAGAAGG - Intergenic
1144432466 17:15206769-15206791 CAGGGGGTGGGGTGGGAGGAAGG + Intergenic
1144611524 17:16722681-16722703 CAAGAGTTGGGGAGGGAAGGTGG - Intronic
1144834840 17:18151365-18151387 CAAGGGGCGCGGTGGGAACAGGG - Intronic
1144901216 17:18592669-18592691 CAAGAGTTGGGGAGGGAAGGTGG + Intergenic
1145131290 17:20353428-20353450 CAAGAGTTGGGGAGGGAAGGTGG - Intergenic
1146277011 17:31522583-31522605 CAAGGGGTGGGGAGAGAGCAGGG - Intronic
1147139251 17:38452282-38452304 CAAGGGGGTTGGGGGGGAGATGG - Intronic
1147361559 17:39933937-39933959 CCAGGCATGTGGTGGGAAGAAGG + Intergenic
1147370114 17:39986757-39986779 CAAGGGGTTTGGCGGGGAGATGG + Intronic
1147635482 17:41961365-41961387 CAAGGCCTGTGGATGGTAGAGGG - Exonic
1147954129 17:44123089-44123111 AAAGGGGTGTCCAGCGAAGAGGG + Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1147978124 17:44259455-44259477 CGAGGGGTGTGGAGGGCTGAGGG + Intronic
1148206700 17:45784171-45784193 GAAGGGGAGCGGAGGGGAGAGGG + Intergenic
1148503001 17:48106188-48106210 CAAGGGCTGAGGAGGGAGGATGG + Intronic
1148587387 17:48790689-48790711 CAAGGGCTGGGAATGGAAGAAGG + Intronic
1148790150 17:50168276-50168298 GAAGGGGTGTGCAGGGATGTGGG + Intronic
1149950986 17:60985659-60985681 AAAGGGTAGTGGAGGGAGGAGGG - Intronic
1150282102 17:63934685-63934707 CAGGGGGTGGGGAAGCAAGAAGG + Intergenic
1150450249 17:65260763-65260785 CCAGGGGTGGGGTGGCAAGAGGG - Intergenic
1151414525 17:73952764-73952786 CAAGGAGGGTGGAGGGTGGAGGG - Intergenic
1151996101 17:77610016-77610038 AAGGGGGTGAGGAAGGAAGAGGG + Intergenic
1152008032 17:77694721-77694743 CAGGGAGTGGGGAGGGAAGGAGG - Intergenic
1152163694 17:78686713-78686735 CAAAGGCAGGGGAGGGAAGATGG + Intronic
1152175045 17:78782003-78782025 CAGGGGGTTTTGAGGGATGAGGG - Intronic
1152789838 17:82273120-82273142 CCAGGGGTGGGGAGGGCAGTGGG - Intronic
1152934041 17:83125658-83125680 CCAGGGGTGTGGCAGGAAAAGGG - Intergenic
1153330377 18:3867466-3867488 CACGGGGTGGGGAAGGAAGGAGG + Intronic
1153525218 18:5988807-5988829 CTAGGGGTGTGGATGGAAAGTGG + Intronic
1153695213 18:7633527-7633549 CAAGAGGAGTGAAGGGAAGGTGG - Intronic
1153821236 18:8833858-8833880 CAAGGGTTGAGGAGGGAATGGGG + Intergenic
1154031183 18:10755824-10755846 CAAGGGATGAGGAGGAGAGATGG + Intronic
1154228985 18:12536573-12536595 GATGGGGAGTGGAGGAAAGAGGG + Intronic
1155048946 18:22129962-22129984 CAAGGGAAGGGAAGGGAAGAGGG - Intergenic
1155241780 18:23870820-23870842 CAGGGGCTGGGGAGGGAAAAAGG + Intronic
1155500138 18:26479535-26479557 CAAGGGGTGTGGAGAGAAAGAGG + Intronic
1157878251 18:51294005-51294027 CAAGGGATGTGGAGGGCTAAGGG + Intergenic
1158406566 18:57165388-57165410 AAAGGCGTGGGGAGGGAAGGAGG - Intergenic
1158423118 18:57313464-57313486 GAAGGGGAGTGGGGGGGAGAAGG + Intergenic
1158483468 18:57843556-57843578 GAAGGGGGCTGGAGGGATGAGGG + Intergenic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1160433999 18:78832155-78832177 CAAAGGCTGAGGAGGGAAGGAGG - Intergenic
1160434038 18:78832297-78832319 CAAAGGCTGAGGAGGGAAGGAGG - Intergenic
1160538283 18:79606975-79606997 CATGAGGTGAGGAAGGAAGACGG + Intergenic
1160679009 19:404625-404647 TGAGGGGTGTGGAGGGGGGATGG + Intergenic
1160679068 19:404755-404777 TGAGGGGTGTGGAGGGGGGATGG + Intergenic
1160679083 19:404788-404810 TGAGGGGTGTGGAGGGGGGACGG + Intergenic
1160679130 19:404887-404909 CGAGGGGTGTGGGGGGGGGACGG + Intergenic
1160679173 19:404982-405004 TGAGGGGTGTGGAGGGGGGATGG + Intergenic
1161124648 19:2549006-2549028 CAAGGTGTGTGGCAGGAACAGGG - Intronic
1161779613 19:6282744-6282766 CAGGGGGTGTGGTGGGGGGAGGG + Intergenic
1161821246 19:6532182-6532204 CAAGGGGGCTGGAAAGAAGAGGG + Intronic
1161977591 19:7615104-7615126 CAGGCTGGGTGGAGGGAAGATGG + Intronic
1162035884 19:7939004-7939026 CCAGGGGTTTGGTAGGAAGAGGG + Intronic
1162499224 19:11041927-11041949 CAAGGGATGAGGTGGGATGAGGG + Intronic
1162629627 19:11916905-11916927 TAAGGGGTGTGGAAAGGAGATGG - Intergenic
1162634680 19:11958135-11958157 TAAGGGGTGTGGAAAGGAGATGG - Intronic
1162830011 19:13278544-13278566 CCGGGGGTGTGGTGGGCAGAGGG - Intronic
1162926357 19:13932223-13932245 CATGGGGGGTGGGGGGCAGAAGG - Intronic
1163350987 19:16777035-16777057 AAAGGGAACTGGAGGGAAGAGGG + Intronic
1163351305 19:16777810-16777832 GAAGGGGAGGGAAGGGAAGAGGG + Intronic
1163709120 19:18835100-18835122 CAGGGGCTGTGGAGGTAGGACGG - Intronic
1163752458 19:19085828-19085850 CAAGAGGAGAGGAGGGGAGAGGG + Intronic
1163864894 19:19764828-19764850 GAAGGGGAGGGGAGGGGAGAAGG - Intergenic
1164394300 19:27850377-27850399 GAAGGGGTGTGGGGTGAGGAGGG + Intergenic
1164441820 19:28284876-28284898 GAAGGAGGGTGGAGGGAAGGGGG + Intergenic
1164574165 19:29396093-29396115 CAGGGGGTGGGGAGGGAGGGAGG - Intergenic
1164588675 19:29494464-29494486 GGAGGGGTGGGGAGGGAGGAAGG + Intergenic
1164588808 19:29494849-29494871 GAAGGGGTGAGGAGGGAGGGAGG + Intergenic
1164648640 19:29876310-29876332 AAGGGGGTGTGCAGGGCAGAGGG + Intergenic
1164686216 19:30168392-30168414 CAGGGGGCGTGTAGGGAAGAGGG - Intergenic
1164853200 19:31501412-31501434 CAAGGGGTGTGGTGGGTCCAGGG - Intergenic
1164958747 19:32408160-32408182 CACGGGGTGTGTTGGGGAGAAGG + Intronic
1165092630 19:33394921-33394943 CAAGGGGTGTGCAGCGGAGGAGG - Intronic
1165362018 19:35342566-35342588 CAAGGGGTGTGAATGGGAAAGGG - Intronic
1165367746 19:35379624-35379646 AAAGGGGAGGGGAGGGAAAAGGG - Intergenic
1165401913 19:35606501-35606523 CAAGGAGGGTGGGGGGAAGGAGG - Intergenic
1165445886 19:35856641-35856663 CAAGGGGTGAGGAGGAGGGAAGG - Intronic
1165461394 19:35946053-35946075 CATGGGGTGGGGCAGGAAGATGG + Intergenic
1165757779 19:38304358-38304380 CCAGGGCTGTGGAGAGAAGTTGG - Exonic
1165828756 19:38720157-38720179 TGAGGGGTGTGGAGTGAAGGTGG - Intronic
1165950659 19:39472512-39472534 CAGGGGATGTGGTGGGTAGAAGG + Intronic
1166338537 19:42123110-42123132 AAAGTGGTGGGGTGGGAAGAGGG - Intronic
1166541238 19:43607566-43607588 GAAGGGGTGGGGTGGGAGGAGGG - Exonic
1167062958 19:47162584-47162606 TAGGGGGTGGGGAGGGTAGAGGG - Intronic
1167153227 19:47722267-47722289 CATGGGGCGGGGAGGGAAGAAGG - Intronic
1167494054 19:49807716-49807738 CAAGGCGGGTGGAGGGAAACAGG + Intronic
1167774234 19:51544433-51544455 CAAGGGGAGTGAGGGGAGGATGG + Intergenic
1167972356 19:53196579-53196601 CCTGGGGTGTGGAGCGAGGAGGG + Intergenic
1168394723 19:56038301-56038323 CCAGGGGTGAGGAAGGAAGTTGG + Intronic
924963619 2:56925-56947 CAGGGGCTGTGGTGGGAAGTGGG + Intergenic
925068952 2:951141-951163 GAGGGGGCGTGGAGGGAGGAGGG - Intronic
925212457 2:2061561-2061583 CCAGAGGGATGGAGGGAAGAGGG + Intronic
925250504 2:2432559-2432581 CATGGGGTGGGGAGGGGGGAAGG + Intergenic
925291524 2:2751461-2751483 AGAGGGGTCTGGAGGGAAGAGGG - Intergenic
926688900 2:15719207-15719229 CAAGAAGTGAGGAGGGAAGACGG + Intronic
926738443 2:16091645-16091667 CAAGGGGTGAGGGGGACAGAGGG + Intergenic
926894311 2:17667915-17667937 CAAGGGCTGTGGAGTCAAAATGG + Intronic
927089884 2:19702286-19702308 GAAGGGGTGTCGAGGGAGGTAGG + Intergenic
927413471 2:22852811-22852833 AAAGAGGTGAGGAGGGAAGTTGG + Intergenic
927517264 2:23679780-23679802 CAGAGGGTGTGGGAGGAAGAGGG + Intronic
927711281 2:25327946-25327968 CAAAGGGCCTGGAGGGAATAGGG - Intronic
927733211 2:25494462-25494484 TAAGGGGGGTGGGGGGAGGAGGG + Intronic
927894699 2:26774272-26774294 CGAGGGCTGTGGAGGGAGCAAGG + Exonic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
929246746 2:39710475-39710497 AAAGGGGAGGGGATGGAAGAGGG + Intronic
929279918 2:40066538-40066560 CAAGAAGTGTGGAGTGAAGTGGG + Intergenic
929434648 2:41919232-41919254 TTTGGGGGGTGGAGGGAAGATGG - Intergenic
929559444 2:42946643-42946665 CAAGGGGAGGGTGGGGAAGAAGG - Intergenic
929562210 2:42963014-42963036 CAGGGAGGGAGGAGGGAAGAGGG - Intergenic
929638407 2:43549003-43549025 CCAGGGGGGTGGAGCCAAGATGG - Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929924066 2:46195007-46195029 CAAGGAGTGTGGATGGAATCTGG - Intergenic
929934153 2:46282184-46282206 GAAGGGTTGTGAAGGGATGAGGG - Intergenic
930479426 2:51927398-51927420 CGAGGGGTGTGTGGGCAAGATGG - Intergenic
930539045 2:52681256-52681278 TAAGGGGTGTGGAGCCAAGCTGG - Intergenic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
930914663 2:56672314-56672336 CCAGGGGGTTGGAGGCAAGATGG + Intergenic
931065618 2:58582968-58582990 AAAGGGGAGTGGAGAGCAGAGGG - Intergenic
931265126 2:60653752-60653774 CATGGGGTGTGGAGAGGAGGAGG - Intergenic
931653536 2:64489663-64489685 GAAGGGGTGGGGAGGGAAAAAGG + Intergenic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
932416907 2:71579083-71579105 CAGGGGGTGTGGGGTGGAGAGGG - Intronic
932496936 2:72150214-72150236 CAAGGGGGGCTGAGGGAAGCAGG - Intergenic
933247607 2:79993639-79993661 CAGGTAGTGTGGAGTGAAGAGGG + Intronic
933657901 2:84904895-84904917 GAAGGGCTGTGGTGGGAACAGGG - Intronic
933663468 2:84946095-84946117 CGAGGGGAGGGGAGGGGAGAGGG + Intergenic
933665309 2:84960086-84960108 GGAGGGGAGTGGAGGGAGGAGGG - Intergenic
933721166 2:85398597-85398619 CAAGCAGGGTGGAGGGGAGAAGG - Intronic
933927307 2:87106050-87106072 CAGGGAGTGTGGAGGGAGGGAGG - Intergenic
934298550 2:91762518-91762540 CAAGGGGTGTTAAGGACAGAGGG + Intergenic
934851208 2:97702368-97702390 CAAGGGGCATGGAGGGAAAATGG - Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
936407095 2:112214545-112214567 CAAGGGGAGCAGAGGGAAGTAGG + Exonic
936575981 2:113656148-113656170 CCAGGGGGGTGGAGCCAAGATGG + Intergenic
937340318 2:121086936-121086958 TCAGGGATGTAGAGGGAAGATGG + Intergenic
938091392 2:128437070-128437092 GGAGGGGTGTGGAGGGGTGAGGG + Intergenic
938177401 2:129146655-129146677 GAAGGCTTGTGGGGGGAAGAGGG - Intergenic
938200261 2:129366982-129367004 AAAGGGGTGTGGAGAGGGGAAGG - Intergenic
938605625 2:132889904-132889926 TGAGTGGTGTGGAGGAAAGAAGG + Intronic
938743139 2:134251896-134251918 CCAGGGGTGGGGAGGAGAGAGGG - Intronic
938841832 2:135171983-135172005 GAAGGGGAGTGAGGGGAAGAGGG + Intronic
939216940 2:139250648-139250670 CAGGGGGTGTGGTGGGGGGAGGG + Intergenic
939217771 2:139262017-139262039 TCTGGGGTGTGGAGGGAAGAAGG - Intergenic
939244517 2:139606454-139606476 CATGGGGGGTGGAGGGAGGGGGG + Intergenic
939639029 2:144617205-144617227 CAGGGGGTGTGGTGGGGGGAGGG - Intergenic
939893598 2:147766519-147766541 CAAGGGGGGTGGAGCCAAGATGG + Intergenic
939934468 2:148273650-148273672 CAAGGAGTTTGGTGGGTAGAAGG - Intronic
940962391 2:159799882-159799904 CAGGGGTTGGGGTGGGAAGAAGG + Intronic
941272561 2:163448692-163448714 CAAGGGGAGGGGAGGGGAGGGGG + Intergenic
942211756 2:173678243-173678265 CAAGAGGGAGGGAGGGAAGAAGG + Intergenic
942288641 2:174447792-174447814 CTAGAGGTGAGGAGGGAGGAAGG + Intronic
942462449 2:176177913-176177935 CGAGGGGGATTGAGGGAAGATGG - Intergenic
942807298 2:179946475-179946497 GAAGGGGAGGGGAGGGAGGAAGG + Intronic
942960984 2:181829650-181829672 CAAGGGGTTGGGAGGAAGGAGGG - Intergenic
944605356 2:201347336-201347358 GCAGGGGTGTGGAGAGAGGAGGG - Intronic
944832732 2:203549124-203549146 AGAGGGGAGGGGAGGGAAGAAGG - Intergenic
944895639 2:204160978-204161000 GAAGGGATGTGGAGAAAAGAGGG + Intergenic
945255901 2:207802894-207802916 CCAGGGGTGGGGAGGGGAAATGG - Intergenic
945694637 2:213087635-213087657 CAGGGAGTGGGGAGGGTAGAGGG - Intronic
946019590 2:216632327-216632349 GGAGGGGTCTGGGGGGAAGAGGG + Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946441535 2:219701129-219701151 AAAGGGGTAGGGAGGGAGGAAGG - Intergenic
946943876 2:224799169-224799191 CTAGGGATGTGGAGGAAGGATGG - Intronic
947736776 2:232459300-232459322 AAGGGGATGCGGAGGGAAGAAGG - Exonic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
947909212 2:233790572-233790594 AAAGGGGAGGGGAGGGAGGAAGG - Intronic
947940237 2:234047825-234047847 CAAGGGATGTGGTGGGGAGCAGG - Intergenic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948175823 2:235942011-235942033 CAAGAGGAGTGCAGGGAGGATGG - Intronic
948386937 2:237586301-237586323 CATGGGGTGCAGAGGGAAGCAGG - Intronic
948666780 2:239539824-239539846 CACGGGGTGTGAGGGGAACAAGG - Intergenic
948840114 2:240644686-240644708 GAAGGGGAGAGGAGAGAAGAGGG - Intergenic
1168803693 20:660742-660764 AGAGGGGTGTGAAGGGAAGGCGG + Intronic
1169506053 20:6213029-6213051 CAATGGGTGAGGAGCGAGGAAGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171139479 20:22728751-22728773 CAAGGGGACTGGAGCTAAGATGG - Intergenic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1172186913 20:33036625-33036647 CTAGGGCTGTGGAGGGAGGGAGG + Intronic
1172343180 20:34175501-34175523 GAAGGGGTGTGGAAGGCAGGAGG + Intergenic
1172487829 20:35309481-35309503 CTAGCAGTGTGGTGGGAAGAAGG - Intronic
1172781302 20:37438420-37438442 GCAGGAGAGTGGAGGGAAGAGGG - Intergenic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173362097 20:42353947-42353969 CAGGGGCTGAGGTGGGAAGATGG + Intronic
1173705541 20:45107761-45107783 CATGGGGTGGGGAGGGGAAAGGG + Intergenic
1173935580 20:46859421-46859443 CATGGAGTGGTGAGGGAAGAAGG - Intergenic
1174362759 20:50039043-50039065 CCAGGGGTGGGGTGGGATGAGGG + Intergenic
1174452413 20:50628541-50628563 CATGGGGAGTGGAGGCAGGAAGG - Intronic
1174744286 20:53046133-53046155 CAAGGGGGCTGCAGGCAAGAGGG + Intronic
1174752167 20:53122567-53122589 CAAGGTGTTTGGAGGGAAGAGGG + Intronic
1175014538 20:55775210-55775232 GGAGGGTGGTGGAGGGAAGAGGG + Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175493797 20:59398463-59398485 GAGGGGGTGTGGGGGGAAAAGGG - Intergenic
1175627016 20:60497328-60497350 AGAGGGGAGGGGAGGGAAGAAGG + Intergenic
1175896203 20:62336524-62336546 CAAGGGGTGGTGAGGGCTGAGGG + Intronic
1176942960 21:14946228-14946250 CAAGGGGTGAGGAAGGAAAAGGG - Intergenic
1177038102 21:16070597-16070619 CAAGGGGGGTGGAGGGAGAGCGG + Intergenic
1177655998 21:24018707-24018729 CAAGGGAAGAGCAGGGAAGAAGG - Intergenic
1177736807 21:25101220-25101242 CAAGGAGTGGTGAGGGAGGAAGG - Intergenic
1178232798 21:30806155-30806177 CGATGGGTGAGGAGGAAAGAAGG + Intergenic
1178415861 21:32404630-32404652 CCAGAGGTGGGGAGGGAAGAGGG + Intergenic
1179489128 21:41728708-41728730 GAAGGCGGGTAGAGGGAAGAAGG + Intergenic
1179885016 21:44310148-44310170 CTAAGGGTGTGGAGAGGAGAAGG - Intronic
1180031085 21:45208454-45208476 CCAGGTGTGTGGCAGGAAGAAGG + Intronic
1180081654 21:45490119-45490141 CAGGGGCTGTGGAGGGATGGAGG - Intronic
1180112758 21:45671596-45671618 CATGGGGTGTTGTGGTAAGAGGG + Intronic
1180146990 21:45927291-45927313 GAAGGGGAGGGGAGGGAGGAGGG - Intronic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180228123 21:46409991-46410013 CAAGGGGTGCGCACTGAAGACGG - Intronic
1180228578 21:46412989-46413011 CAAGGTGTGGGGAGGGGGGAAGG + Exonic
1180228690 21:46413348-46413370 CAAGGTGTGGGGAGGGGGGAAGG + Intronic
1180480822 22:15752099-15752121 CAGGGGGTGTTGTGGGAAGGTGG - Intergenic
1180858701 22:19064465-19064487 CAAGGGGTGTGCAGTGTAGGTGG - Intronic
1180913252 22:19468166-19468188 CAAGTGATGTGGAAGGAAGAAGG + Intronic
1181167270 22:20990539-20990561 CCAGTGGGGTGGAGGGAGGACGG + Intronic
1181487211 22:23238867-23238889 CAAGGGGGGTGGGGGGCAGGTGG + Intronic
1181624884 22:24116529-24116551 CAAAGGGTGGGCAGGCAAGATGG - Intronic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1183044258 22:35207225-35207247 CAAGGGTTGTGATGGGAATAAGG - Intergenic
1183382313 22:37496367-37496389 CATGGGGTGGGGAGGGACCAAGG - Intronic
1183492955 22:38126555-38126577 CAGGGGGAGTGGGGGGATGAGGG - Intronic
1183858807 22:40654103-40654125 CACGGGGTATGGGGGGAAGCAGG + Intergenic
1183985503 22:41567973-41567995 AATTGGGTGTTGAGGGAAGAGGG - Intronic
1184092369 22:42299412-42299434 CTAGGAGTGGGGAGGGGAGATGG - Intronic
1184464788 22:44662487-44662509 CCAGGGGTGTGTAAGGAAGATGG - Intergenic
1184531454 22:45058354-45058376 GAAGGGGAGAGGGGGGAAGAGGG + Intergenic
1184617602 22:45648618-45648640 CAGGGGGTGTGGTGGGACGGAGG - Intergenic
1184685501 22:46094993-46095015 CCAGGGGAGGGGAGGGGAGACGG - Intronic
1184947486 22:47813830-47813852 GATGGGGTGCGCAGGGAAGAGGG + Intergenic
1185310057 22:50149360-50149382 CTAGAGATGTGGAGGGAAGAAGG - Intronic
949386644 3:3509921-3509943 CAGGGGGTGGGGAGAGAAGGGGG + Intergenic
950671313 3:14527425-14527447 GGAGGGGAGGGGAGGGAAGAGGG + Intronic
950903411 3:16516477-16516499 GATGGGGTCTGGTGGGAAGAAGG - Intergenic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951089520 3:18556043-18556065 CAGGGGATTTGGAGGAAAGATGG - Intergenic
951201585 3:19881263-19881285 CAAGGAGTGGGGAAGGAAGCAGG - Intronic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952136342 3:30426353-30426375 GAATGGGGGTGGATGGAAGAAGG + Intergenic
952253781 3:31678329-31678351 CATGCTGTGTAGAGGGAAGAAGG + Intronic
952295272 3:32056696-32056718 CAAGGGTTGCAGAGGGACGAAGG - Intronic
953241715 3:41155422-41155444 CTCGGGGTGTGCAGGGAAAAGGG + Intergenic
953759297 3:45674253-45674275 CGTGGGGTGGGGAGGGAAGAGGG - Intronic
954414248 3:50385182-50385204 AAGGGGGAGGGGAGGGAAGATGG + Intronic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
954934398 3:54313449-54313471 CCAGGGGTGTTGAGGGTAGGAGG - Intronic
955875252 3:63482488-63482510 CAAGGTGTGTGGCAGGGAGAAGG - Intronic
956510236 3:69985449-69985471 CAAAGGGTGGGGAGGGGTGATGG + Intergenic
956644785 3:71444891-71444913 CATGGGGACTGGAGGGTAGAGGG + Intronic
956696204 3:71921355-71921377 TAAGGGGTCAGGAGGGAAGCAGG + Intergenic
956796014 3:72719389-72719411 GAAGGGGAGGGGAGGGAGGAAGG + Intergenic
957008691 3:74980810-74980832 GAAGAGGTGAGGAGGGAATACGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958421414 3:93936082-93936104 GAAGGGGTGTGGGGGGGAGATGG - Intronic
958484693 3:94689696-94689718 GAAGGGGAGTGAAGGGAAGTTGG + Intergenic
959521394 3:107326567-107326589 GCAGGAGTTTGGAGGGAAGAAGG + Intergenic
960169198 3:114438519-114438541 CAAGGTGCTTGGAGGAAAGAAGG + Intronic
960747129 3:120902335-120902357 TAAGGGGGGTGGAGCCAAGATGG - Intergenic
961532275 3:127547100-127547122 CAAGAGGAGAGGAGGGGAGAGGG + Intergenic
962046028 3:131759900-131759922 TAAGTGCTGTGGAGGGCAGAAGG + Intronic
962082858 3:132158828-132158850 CATGGTGTGTGAAGGGAGGATGG + Intronic
963263711 3:143218137-143218159 TTAGGGGTGGGGAGGGAGGAGGG + Intergenic
963817209 3:149844891-149844913 TAAGGGTTTTGGAGGGGAGATGG - Intronic
964291074 3:155180622-155180644 GAAAGGGTGTGGAGGGAGGAAGG + Exonic
965106569 3:164363058-164363080 CGAGTGGAGTGGAGGGCAGACGG + Intergenic
965257546 3:166434509-166434531 AGAGGTTTGTGGAGGGAAGAGGG - Intergenic
965285342 3:166812022-166812044 GGAGGGATGTGGAGGGAGGAAGG + Intergenic
965520521 3:169664849-169664871 CAAAGGCTGTGGAGGGAAAGGGG + Intergenic
966351222 3:179034427-179034449 GGAGAGGTGGGGAGGGAAGAAGG - Intronic
966754513 3:183355934-183355956 CAAGGGGAGGGGAGGGGGGAAGG - Intronic
967531134 3:190549897-190549919 AAAGGGGTACGGAGTGAAGATGG + Intronic
968086941 3:195878045-195878067 AAAGGGTGGTGGAGGGAAGCTGG + Intronic
968137212 3:196228093-196228115 CCTGGGGTGGGGAGAGAAGAGGG - Exonic
968264262 3:197350497-197350519 CAGGGGCTGGGGAGGGAGGAAGG - Intergenic
968890341 4:3365342-3365364 CAGGGAGTCTGGAGGGAGGAGGG + Intronic
969232671 4:5842538-5842560 CAGGGAGTGTGGAAGGAGGAAGG - Intronic
969350109 4:6593480-6593502 CCAGGGGTCTGCAGGGAAGGAGG - Intronic
969363744 4:6681837-6681859 CAACGACTGTGGATGGAAGAGGG + Intergenic
969367934 4:6710333-6710355 CCAGGGGTGGGGAGGACAGAAGG - Intergenic
969477788 4:7431253-7431275 CAAGGGGTGGGTAGGGAAGAGGG + Intronic
969492542 4:7508218-7508240 AAGGGGGTGAGGAGGGATGAAGG + Intronic
969586392 4:8096709-8096731 CAGGGGCTGGGGAGGGAAGGGGG + Intronic
969591481 4:8124418-8124440 CAGGGGCTGCGGAGGGAAAACGG - Intronic
969658333 4:8510648-8510670 CAGGGGGTGTCAGGGGAAGAGGG + Intergenic
970897096 4:21117047-21117069 CAAGGGGTTTGGAGAGAATTAGG - Intronic
971176416 4:24286665-24286687 TAAGGAGTGTGGAGGAAAGGTGG - Intergenic
971692785 4:29859046-29859068 CAAGGGGTTGGGAGGTAAGGGGG - Intergenic
972373526 4:38448908-38448930 TAAGGGGGGTGGAGTCAAGATGG - Intergenic
972576230 4:40354409-40354431 CAAGGGGAGTGAATGGAAGAAGG + Exonic
972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG + Intronic
972644463 4:40954373-40954395 CACGGGGTGGAGAGGAAAGAGGG + Intronic
973081129 4:45995207-45995229 CAAGGAGTGGTGAGGGAGGAAGG - Intergenic
974020548 4:56688320-56688342 GAAGGGGAAGGGAGGGAAGAAGG + Intergenic
975813161 4:78190597-78190619 GAAGGGGTGTGGTGGGGGGATGG - Intronic
976258646 4:83124865-83124887 GGAGGGGTGTGGGGGGAGGAGGG + Intronic
976443188 4:85100584-85100606 CATGGAGTGGTGAGGGAAGAAGG - Intergenic
976476682 4:85492076-85492098 GAAGGAGGGAGGAGGGAAGAGGG - Intronic
976830937 4:89313008-89313030 AAAGGGGTGGAGAGAGAAGAAGG - Intergenic
977673901 4:99726715-99726737 TAAGGGTTGCGGAGGGATGAAGG + Intergenic
979739549 4:124131945-124131967 AACGGGGTGTGGAGCCAAGATGG - Intergenic
980076950 4:128303843-128303865 CAAGTGCTGGGGAGGGATGATGG + Intergenic
980528421 4:134018502-134018524 GAAGGTGGGTGGAGGTAAGAGGG - Intergenic
980754158 4:137135870-137135892 GAATGAGTGTGGAGGGAAGGGGG - Intergenic
980836730 4:138203108-138203130 ATTGGGGTGGGGAGGGAAGAAGG - Intronic
980984868 4:139685317-139685339 CATGGAGTGGGGAGGGAGGAAGG + Intronic
981010707 4:139922056-139922078 CCAGGTCTGTGGAGGGCAGAGGG + Intronic
982384090 4:154781431-154781453 GAAGGGGTGAGGAGGGGAAAGGG + Exonic
982405636 4:155016718-155016740 GCAGGGATGTGGAGAGAAGATGG + Intergenic
983257014 4:165411322-165411344 GAAGAGGGATGGAGGGAAGAAGG - Intronic
983399135 4:167240968-167240990 CATGTCTTGTGGAGGGAAGAAGG + Intergenic
984139005 4:175978501-175978523 GAAGGTATGTGGAGGCAAGAGGG - Intronic
984305099 4:177979404-177979426 CAAGAGGAGTTGAGGGAACATGG + Intronic
984446592 4:179844617-179844639 GATGGAGTGTGGAGGGAAGCAGG - Intergenic
984541188 4:181039621-181039643 CAGGGGGTGGGGAGGGATAAGGG - Intergenic
984652596 4:182286527-182286549 AAAGGGCTGGGGAGGGTAGAGGG - Intronic
985025702 4:185737318-185737340 CAGGGGGTGTGGAGAGCAGGTGG + Intronic
985586452 5:740122-740144 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985601040 5:832299-832321 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985691448 5:1314920-1314942 CCAGGGGTCTGGAGGAAGGATGG - Intergenic
985699337 5:1361110-1361132 CTAGGGGTTTTGAGGGCAGAGGG + Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986004032 5:3652614-3652636 CAAGGAGGGTGGAGGGAGGAGGG + Intergenic
986081102 5:4394991-4395013 CTAGGGGAGTGGAGTGCAGAAGG - Intergenic
986393630 5:7306557-7306579 CATGGGGTGGGGAGGGAGGTGGG + Intergenic
986769441 5:10958391-10958413 CAGGGGATGTGGAGGAAGGAGGG - Intergenic
987111800 5:14694360-14694382 CAAGGGGTGTGGACTGCAGATGG + Exonic
987216900 5:15747056-15747078 GAATGAGTGTGGAGGGAAAAGGG + Intronic
988400100 5:30751366-30751388 CCAGGGGTCTGGAAGGAAAAGGG - Intergenic
988423657 5:31037424-31037446 GAAGGGGAGTGTGGGGAAGAGGG + Intergenic
989261779 5:39426381-39426403 CTAGGGGTGTGGAGGCAGGGAGG + Intronic
990097036 5:52129006-52129028 CCAAGGGTTTGCAGGGAAGAAGG + Intergenic
990407233 5:55503809-55503831 GAAGGGGAGGGGAGGGAAGAGGG + Intronic
990516945 5:56539208-56539230 CATGGGGTGGAGAAGGAAGAGGG + Intronic
990953832 5:61324209-61324231 GAAGGGGAGGGGAGGGAAGTGGG + Intergenic
991354581 5:65754672-65754694 TATGGGGTGTGGGAGGAAGAGGG - Intronic
991493792 5:67208545-67208567 GAAGGGGTCTGGAGGGAAGCAGG + Intergenic
991643392 5:68776489-68776511 CAAGTTCTCTGGAGGGAAGAGGG + Intergenic
992157652 5:73970941-73970963 CAGGGAGTGGGGAGGGAGGAAGG + Intergenic
992818865 5:80473409-80473431 TAAGGGGTCTGGAGCAAAGAAGG + Intronic
993176154 5:84488556-84488578 CCAGGGGTTTGAAGGGAAGGAGG + Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
995013819 5:107288050-107288072 GAAGGGTTGTGGTGGGAGGAAGG - Intergenic
995015027 5:107300256-107300278 CAAGGGAGTTGGAGGAAAGAAGG + Intergenic
995207446 5:109497433-109497455 CAAGAGGGATGGAGGGAAGAAGG + Intergenic
996205863 5:120734271-120734293 ACAGGAGTGAGGAGGGAAGAGGG + Intergenic
996253161 5:121363402-121363424 CTAGAGGTGTGGAGAGAGGAAGG + Intergenic
996564310 5:124863551-124863573 AAAGGGGGGGGGAGGGAAGCAGG - Intergenic
997632688 5:135380635-135380657 CTAGGGGTGTTGAGGGATTAAGG + Intronic
998207912 5:140172605-140172627 CAAGGACTGTGGAGGCAACATGG - Intergenic
998593904 5:143507583-143507605 GAAGGGGAGTGAAGGGAAGTGGG - Intergenic
999261568 5:150241818-150241840 GGAGGGGAGTGGAGGAAAGAGGG - Intronic
1000828568 5:166075771-166075793 GAAAGGGGGAGGAGGGAAGAAGG + Intergenic
1001048565 5:168395303-168395325 CAAGGGGTGTGGGGCGGAGCGGG - Intronic
1001141341 5:169146536-169146558 AAGGGGGTGTGGAGGTCAGAAGG - Intronic
1001310678 5:170608051-170608073 CAAGGAGTGAGGACAGAAGAAGG + Intronic
1001927161 5:175646321-175646343 CATGGGGTGATGTGGGAAGAAGG - Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002285819 5:178162067-178162089 CTAGGGGTGAGGAGGGAACGAGG + Intergenic
1003106546 6:3220987-3221009 CGAGGGGTGGGGAGGCAGGAAGG + Intergenic
1003142742 6:3485266-3485288 CAAGGGATGAGGAGAGAACAGGG + Intergenic
1003388598 6:5692318-5692340 GAAGGGGGGTGGAGCCAAGATGG - Intronic
1003583760 6:7367152-7367174 GAAGGGGGATGGAGGGAAGAGGG - Intronic
1003618231 6:7674203-7674225 CACGAGGTCTGGAGGGTAGAAGG + Intergenic
1003822915 6:9920102-9920124 CTAGTGGTGTGGATAGAAGATGG + Intronic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004725658 6:18308968-18308990 GGAGGGGAGGGGAGGGAAGAAGG - Intergenic
1004975873 6:20965331-20965353 GGAGGGGAGGGGAGGGAAGAGGG + Intronic
1005786728 6:29251690-29251712 AAAGGGGAATGGAGGGCAGAAGG + Intergenic
1005984738 6:30864337-30864359 CATGGAGTGGTGAGGGAAGAAGG - Intergenic
1007246947 6:40469863-40469885 CAGGGTGTGTGCAGGGTAGAGGG - Intronic
1007340543 6:41188572-41188594 GAAGGGCTGTGGAGGGTGGAAGG - Intergenic
1007718438 6:43870611-43870633 AAAGGGGAGGGGAGGGGAGAAGG - Intergenic
1007791517 6:44311552-44311574 CATGGGGTGGGGGGGGAAGACGG + Intronic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1007939461 6:45765478-45765500 AAAGGGGAGAGGAGGGAAGAAGG - Intergenic
1008132325 6:47733103-47733125 CAGGGGGTGTAGAGGGAAAAAGG - Intergenic
1008349838 6:50477534-50477556 GAAGGGGGGTGGAGCAAAGATGG + Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008548610 6:52605829-52605851 GGAGGGGAGAGGAGGGAAGAAGG - Intergenic
1008625553 6:53312510-53312532 CAAAGGGTGTGAAGGCAGGATGG + Intronic
1008969181 6:57346779-57346801 CCAGGGATGTGGAGGGCAAATGG + Intronic
1009158159 6:60248597-60248619 CCAGGGATGTGGAGGGCAAATGG + Intergenic
1010329466 6:74606330-74606352 CAAGGGTTGGGGTTGGAAGAAGG - Intergenic
1010341028 6:74752740-74752762 CACTGGGTGTTAAGGGAAGAAGG - Intergenic
1010661625 6:78578079-78578101 CAAAGTCTTTGGAGGGAAGAGGG + Intergenic
1010856522 6:80847736-80847758 CAAGGGGGGAGGAGCCAAGATGG + Intergenic
1011277311 6:85643390-85643412 CAAGGGGTGAGGAGCGGGGAAGG - Intronic
1011632339 6:89339551-89339573 GAAGGGATGGGGAGGGAAGAGGG + Intronic
1012162620 6:95905233-95905255 AAAGGGGTGAGGTAGGAAGAAGG - Intergenic
1012431481 6:99168311-99168333 GAAGGGGAGGGGAGGGAAGAAGG + Intergenic
1012863082 6:104585030-104585052 AAATAGGTGTGGAAGGAAGAAGG - Intergenic
1013215981 6:108027700-108027722 AAAAGGGTGAGGAGGGAAGGAGG - Intergenic
1013217367 6:108040010-108040032 CATGGGGTGGGGAGGGAGGTGGG + Intergenic
1014877977 6:126684737-126684759 GAAGGGGGAGGGAGGGAAGAGGG + Intergenic
1015142463 6:129950436-129950458 CACAGGCTTTGGAGGGAAGAGGG + Intergenic
1015575804 6:134669826-134669848 CAAGGGGTTGGGAGTGGAGATGG - Intergenic
1015970805 6:138741225-138741247 GCAGGGATGGGGAGGGAAGATGG - Intergenic
1016440353 6:144076925-144076947 CAAGGGCGGTGGAGGGGACAGGG - Intergenic
1016575409 6:145564783-145564805 CAGGGGGTGTGGAGGGAGCTGGG + Intronic
1017470944 6:154736177-154736199 CAAAGTGTGTGTGGGGAAGAGGG - Intronic
1017570817 6:155742365-155742387 AAAGGGGTGTTGAGGGAAGAGGG - Intergenic
1018331123 6:162728032-162728054 CTAGGGGCGGGGCGGGAAGAGGG - Intronic
1018611329 6:165650364-165650386 AAAGGGAGGTGGAGGGGAGAAGG - Intronic
1018646598 6:165954609-165954631 CAGGTGGTGAGGAGGGAGGACGG - Intronic
1018670400 6:166172296-166172318 CAAGGGACGTGGAGGAAATAAGG - Intergenic
1018844679 6:167547393-167547415 GATGGGGTGAGGAGGGAGGAGGG - Intergenic
1018937175 6:168281104-168281126 CCACGGGTGGGGAGGGAAGGCGG + Intergenic
1018962888 6:168460647-168460669 AAAGGAGTGTGGAAGGAAGTTGG - Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019494907 7:1333325-1333347 GAGGAGGTGAGGAGGGAAGAGGG - Intergenic
1019522251 7:1466276-1466298 GAAGGGCTGTTGAGGGAAGGTGG - Intergenic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019932105 7:4230453-4230475 GAAGGGGAGTGGAGGGCAGGGGG + Intronic
1020622721 7:10537227-10537249 AAAGGGGTGTCAGGGGAAGATGG - Intergenic
1020876583 7:13702448-13702470 GAAGGAGGGAGGAGGGAAGAAGG + Intergenic
1021579898 7:22141632-22141654 CATGAGGTGTGGAGGCAACACGG - Intronic
1021661538 7:22924193-22924215 AAAGGGGGGTGGAGCCAAGATGG + Intergenic
1022019811 7:26387625-26387647 CGAGGGGGGTGGAGGAAGGAAGG - Intergenic
1022053933 7:26709361-26709383 CAAAGGGTGTGGAGTGGAAAAGG + Intronic
1022089125 7:27096383-27096405 CGAGAGGTGAGAAGGGAAGAGGG + Intergenic
1022913174 7:34920040-34920062 CAAGAGGTGAGCAGGGCAGAGGG - Intergenic
1023156405 7:37256606-37256628 AAAGGGGAGGGGAGGGCAGAGGG + Intronic
1023862998 7:44226797-44226819 GGGGGGGTGTGGGGGGAAGATGG + Intronic
1023863279 7:44227595-44227617 CAGGGGGTGTGGGGGACAGAGGG + Intronic
1023937009 7:44747548-44747570 GAAGGGAAGGGGAGGGAAGAAGG + Intergenic
1023963001 7:44943258-44943280 CTAGGGGTTTGGAAAGAAGAGGG + Intergenic
1024189428 7:46990672-46990694 CAGGGGCTGGGGAGGGAAAATGG + Intergenic
1024873344 7:53991809-53991831 TAAGGGGTGTGGAAGGTAAATGG + Intergenic
1026522351 7:71128422-71128444 CAAGGGGGGTGGGGGGGAAATGG + Intergenic
1026601727 7:71783104-71783126 AATCAGGTGTGGAGGGAAGATGG + Exonic
1026829101 7:73600561-73600583 CAAGTGGGGTGGGGGCAAGAGGG + Intronic
1029310629 7:99660195-99660217 AAAGGAGTGTGGCGAGAAGATGG - Intronic
1029590831 7:101506037-101506059 CAAGGGCTGTGGTGTGAGGATGG - Intronic
1029620770 7:101688637-101688659 CCAGGGGTGGGGAGGGAGGGTGG - Intergenic
1030012881 7:105188970-105188992 TAAAGGGGGTGGAGGGAGGAAGG + Intronic
1030966137 7:115995195-115995217 CATGGGGTGGGGAGGGGGGAGGG + Intronic
1031100668 7:117476235-117476257 CAAGGAGGTTGTAGGGAAGAGGG + Intronic
1031176449 7:118358466-118358488 CAAAGGGTGAGGATAGAAGAGGG - Intergenic
1031826598 7:126573508-126573530 CAAGCTTTGGGGAGGGAAGAGGG + Intronic
1031858077 7:126946016-126946038 CAAAGGGTGTGGATGTAGGAAGG - Intronic
1031866117 7:127039959-127039981 GAAGGGGTATGGAGGGGAAAGGG + Intronic
1032453490 7:132054264-132054286 GAAGGGGTGGGGAGTGATGAAGG + Intergenic
1032512620 7:132483976-132483998 CCAGGGATGTGCAGGGAAGGTGG + Intronic
1033025974 7:137772919-137772941 CAATGGGGGTGGAGAGAGGAAGG + Intronic
1033290592 7:140079489-140079511 CACTGGTTGTGGTGGGAAGAGGG + Intergenic
1033825648 7:145186860-145186882 GAAGGGGAGGGGAGGGAGGAAGG - Intergenic
1034338626 7:150338814-150338836 CAAGGGATGTGGAGGGGATGTGG - Intronic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034569180 7:151941455-151941477 CATGGGGTGGGGAGGTAGGAGGG - Intergenic
1034796224 7:154015982-154016004 CATGGAGTGTGCAGGGAAAAGGG - Intronic
1034985973 7:155515570-155515592 CGAGAGGTGTGGAGGGTGGAGGG + Intronic
1035046433 7:155970538-155970560 CAAGAGCCCTGGAGGGAAGACGG - Intergenic
1035271521 7:157722684-157722706 ACAGGGGTGAGGAGGGAAGGAGG + Intronic
1035289756 7:157830260-157830282 TAAGGGCTGAGTAGGGAAGAAGG - Intronic
1035482926 7:159201946-159201968 CAAAGGGTGTGGAGTCAAGGAGG + Intergenic
1035645273 8:1214135-1214157 AATGAGGTGTGGAGGGAAGGGGG - Intergenic
1035649953 8:1256871-1256893 CAAGGCCTGTGGAGGGAGGCGGG - Intergenic
1035770404 8:2142686-2142708 GAAGGGGAGGGGAGGGAGGAAGG - Intronic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1037826350 8:22162815-22162837 CAAGGGGAGTGGAGGGGAGGAGG + Intronic
1037881119 8:22573963-22573985 GCAGGGGTGTGCAGGGAAAAGGG + Intronic
1038400431 8:27280303-27280325 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1038524447 8:28261120-28261142 CAAGGAGGGAGAAGGGAAGAGGG - Intergenic
1038545958 8:28425872-28425894 CAGGGGGTGAGGCGGGAGGATGG - Intronic
1040790852 8:51228228-51228250 CAAGATATGTGGAGGGAAGCCGG + Intergenic
1041210248 8:55543442-55543464 CAAGGGGTCAGGGTGGAAGAGGG + Intergenic
1041527521 8:58823798-58823820 CTAGGGGCGAAGAGGGAAGAAGG + Intronic
1041719588 8:60964138-60964160 GAGGGGGTGGGGAGGGAAGAAGG + Intergenic
1042204701 8:66317436-66317458 CAAGGGTTGTGGGGGAAGGAGGG + Intergenic
1042564566 8:70099063-70099085 GAAGGGGAGGGGAGGGGAGAAGG + Intergenic
1042580497 8:70272623-70272645 CAAGGGGTGTGCACGTAAGAGGG + Intronic
1044012359 8:87010206-87010228 CAAGGGAAGTGGGGGGAAAAAGG - Intronic
1044192022 8:89330580-89330602 CAAGGGGTGTGGGGGGCTAAGGG + Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044399368 8:91752782-91752804 CCAGGGTCGTGGAGGGAAGGAGG - Intergenic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044602050 8:94015092-94015114 CAGAGGGTGTGGATGGAAAAAGG - Intergenic
1044866254 8:96574030-96574052 GAGGGGGTGTGGAGGGGAGGGGG - Intronic
1045319092 8:101068170-101068192 CAAGGGGTGGGGAGTGAACCAGG - Intergenic
1045343643 8:101275165-101275187 CAAAGGGTGTGGAGAGCAGATGG - Intergenic
1045385958 8:101671030-101671052 CAAGGGGGGTGGAGCCAAGATGG + Intergenic
1045649591 8:104329586-104329608 GAAGGGGTGTGGGGGGATGAGGG + Intergenic
1045959823 8:107953922-107953944 CAAGGGCTGTGGAGACAAGTAGG - Intronic
1046360494 8:113147660-113147682 GTAGGTGTGTGGAGGGGAGAGGG + Intronic
1046462045 8:114552132-114552154 CAACTGGAGTGGAGTGAAGAAGG - Intergenic
1047015400 8:120718390-120718412 CCAGGGGTGGGAAGAGAAGAGGG + Intronic
1047220925 8:122917450-122917472 CATGGGGTGGGGAGAGATGAGGG - Intronic
1047364726 8:124201464-124201486 GAGGGGGTGGGGAGGGACGATGG - Intergenic
1047731934 8:127735586-127735608 CAGGGAGAGTGGAGGAAAGAAGG - Intronic
1047965273 8:130041809-130041831 GATGGAGTGTGGAGGGAACAAGG + Intergenic
1048093071 8:131262091-131262113 TAAGGGGGGTGGAGCCAAGATGG + Intergenic
1048432420 8:134382577-134382599 CAAGTGGCAAGGAGGGAAGAGGG - Intergenic
1048443099 8:134474450-134474472 AAAGGGGTGGAGAGGGGAGATGG + Intergenic
1049271897 8:141700508-141700530 GAAGGGAGGAGGAGGGAAGAGGG + Intergenic
1049280714 8:141742761-141742783 CAAGTGGGGTGGAGGGGAGAGGG - Intergenic
1049613964 8:143568310-143568332 CAAAAGGTGGGGTGGGAAGAGGG + Intronic
1049702903 8:144023142-144023164 AAAGGGGTCCTGAGGGAAGAGGG - Intronic
1049737723 8:144218727-144218749 AGAGGGGAGGGGAGGGAAGAGGG - Intronic
1050134067 9:2442875-2442897 CAAAGGGTGAGGAGACAAGATGG - Intergenic
1051256841 9:15222496-15222518 CAAGGGCTTTTGAGAGAAGAGGG - Intronic
1051327099 9:15983949-15983971 CAATGGTTCTGGTGGGAAGATGG - Intronic
1053160373 9:35809918-35809940 TGAGGGGTGAGGAGGGAAGTGGG - Intronic
1055067306 9:72131728-72131750 CTAGCAGTGAGGAGGGAAGATGG - Intronic
1055770435 9:79711033-79711055 GAAGGGATGTGGGGAGAAGAGGG - Intronic
1055786962 9:79881548-79881570 GAAGGAGAGGGGAGGGAAGAGGG - Intergenic
1056322024 9:85444276-85444298 AAAGAGGTATGGAGGGAAGAAGG - Intergenic
1056350270 9:85742082-85742104 CAAGGGACGCGGCGGGAAGAGGG - Intergenic
1056805792 9:89727616-89727638 AGGGGGGTGTGGAGGGGAGATGG + Intergenic
1056920111 9:90780058-90780080 GTAGGGGTTTGGTGGGAAGAGGG - Intergenic
1057217011 9:93234692-93234714 CATGGGATGTGGAGGGGACATGG + Intronic
1057506369 9:95636605-95636627 CAAGGGGTGGGGTGGGAAACAGG + Intergenic
1057775058 9:98001155-98001177 AAAGGGGGGTGGCGGGGAGAAGG - Intronic
1057836445 9:98449237-98449259 CAAGGCCTCTGGAGGAAAGACGG - Intronic
1057861032 9:98641047-98641069 CAATAGGGGTGGAGGGGAGAAGG - Intronic
1057937718 9:99254718-99254740 CATGGGGTGGGGAGGGATGGAGG - Intergenic
1058844662 9:108945038-108945060 CAAGGGGTTTGCAGGCTAGAAGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059124235 9:111668422-111668444 GGAGGGGAGGGGAGGGAAGAAGG - Intronic
1059542500 9:115144314-115144336 GGAGGGGAGTGGAGGGGAGAAGG - Intronic
1059542520 9:115144366-115144388 GAAGGGGAGGGGAGGGGAGAAGG - Intronic
1059735684 9:117097222-117097244 AGAGGAGTGTGGAGGGAAAAGGG + Intronic
1060017333 9:120098154-120098176 CAGAGGGTGGGGTGGGAAGATGG + Intergenic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1061009531 9:127946749-127946771 AAAAGGGAGTGGAGGGAAGCTGG + Intronic
1061010406 9:127951097-127951119 CGAGGGATGGGGAGGGAAGTGGG + Intronic
1061895605 9:133645649-133645671 GTAGGGGTGTCGAGGGAAGAAGG + Intronic
1061899703 9:133666574-133666596 AAAGGAGGGAGGAGGGAAGAGGG - Intronic
1061960902 9:133988604-133988626 TAAGGGGTGGGGATGGGAGAGGG - Intronic
1062005030 9:134234793-134234815 CCAAGGGTATGGCGGGAAGAGGG - Intergenic
1185746759 X:2579648-2579670 CAAGAAGAGTTGAGGGAAGAGGG - Intergenic
1185859209 X:3562016-3562038 CAGGGGCTGGGGAGGGGAGAAGG - Intergenic
1185915011 X:4025715-4025737 AGAGGGGAGGGGAGGGAAGAAGG - Intergenic
1185998827 X:4986190-4986212 AAAGAGGGGGGGAGGGAAGAAGG - Intergenic
1186849742 X:13569024-13569046 CAAAGGGTGTGGACGTAGGAAGG + Intergenic
1187237127 X:17477850-17477872 AAAGGGGTGTGGATAGAGGAAGG + Intronic
1187830691 X:23378384-23378406 CGAGGGGTGTGGTGGGAGTAAGG - Intronic
1188423731 X:30022422-30022444 CCAGGGGTTTGGAGGCAAGGAGG - Intergenic
1188811220 X:34656609-34656631 CCAGGGATGGGGAGGGAAGAGGG + Intronic
1189002162 X:36958312-36958334 CCAGGGATGGGGAGGGAAGAGGG - Intergenic
1189178692 X:38982855-38982877 TAGGGGGTGTGGATGGAAGGAGG + Intergenic
1189201029 X:39195708-39195730 CAAGAACTGTGGAGGGAGGATGG - Intergenic
1189502629 X:41577682-41577704 CAAGGGGAGTGAGGGGAAGCAGG - Intronic
1190008006 X:46758664-46758686 CGAGGGGTGTGGAGGGCGGGGGG + Intronic
1190245085 X:48685663-48685685 CTTGGGGTGTGGAGAGGAGATGG + Intronic
1190322691 X:49187911-49187933 GTAGGGGTCTGGAGGGGAGAAGG + Exonic
1190408311 X:50109925-50109947 CATGGGGTGGGGAGGGGGGAGGG - Intergenic
1190476643 X:50834603-50834625 CATGGGGTGTGGAGTACAGAGGG - Intergenic
1190602931 X:52111119-52111141 TAAGGGGGGTGGAGCCAAGATGG + Intergenic
1190826829 X:54025491-54025513 GAAGGGGTGTGTTGGGGAGATGG - Intronic
1191904851 X:66077112-66077134 GAAGGGGAGGGAAGGGAAGAAGG - Intergenic
1192215724 X:69156864-69156886 CAAGGCCTGTGGAGAGAAGGTGG - Intergenic
1192233506 X:69281745-69281767 TAAAGGGTGAGGAGGCAAGAGGG - Intergenic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1192591451 X:72363317-72363339 CCAAGGGTGGGGATGGAAGAAGG + Intronic
1192884153 X:75319639-75319661 CATGGGGGGTGGAGCCAAGATGG - Intergenic
1193046572 X:77060667-77060689 CCAGGGATTTGGAGGGAAAAAGG - Intergenic
1193403687 X:81076915-81076937 CATGGGGTGTGGAGGGCAGGGGG + Intergenic
1193787160 X:85773016-85773038 ACAGGGGGGTGGAGGCAAGATGG - Intergenic
1194813424 X:98414993-98415015 GATGGGGTGTGGAGCCAAGAGGG + Intergenic
1194988085 X:100512962-100512984 GAAGGGTTGGGTAGGGAAGATGG - Intergenic
1195010371 X:100727854-100727876 CAGGGAGTGCTGAGGGAAGAGGG + Intronic
1195248273 X:103017071-103017093 CAAGGAGTAGGGAGGGATGAAGG - Intergenic
1195740545 X:108060888-108060910 CCAGGGGTATGGAGGGAACAGGG - Intronic
1195933967 X:110107644-110107666 GGAGGGGAGGGGAGGGAAGAAGG - Intronic
1196237448 X:113299785-113299807 CAGGGGATGGGGAGGGGAGAGGG - Intergenic
1196371473 X:114984211-114984233 AAAGGGGAATGGAGGCAAGATGG + Intergenic
1196782989 X:119399572-119399594 CACCGGGTGTGGCGGGCAGAGGG + Exonic
1196820458 X:119696443-119696465 GAAGGGCTGAGGAGGCAAGAGGG + Intergenic
1197569730 X:128134075-128134097 CCAAGGGTTTGGGGGGAAGAAGG + Intergenic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1197608623 X:128613676-128613698 AAAGGTCTGTGGAGGGAAAAAGG + Intergenic
1197832082 X:130653794-130653816 TAAGAGGTGGGGAAGGAAGAAGG + Intronic
1197849670 X:130844273-130844295 CAAGGGGGGAGTAGGGAAGCGGG - Intronic
1198459208 X:136847296-136847318 CCAGGGGTGAGGGAGGAAGAAGG - Intergenic
1198525076 X:137492646-137492668 CAATGGCTGTGGAAGGAAGGGGG + Intergenic
1198670776 X:139078145-139078167 AAAGTGATGGGGAGGGAAGAAGG + Intronic
1199539914 X:148947408-148947430 CAAGGGATGTGGAGAGGGGAGGG - Intronic
1199805719 X:151298483-151298505 AAAGGGGGGAGGGGGGAAGAGGG - Intergenic
1201494341 Y:14576706-14576728 CATGGGGGGTGGAGCCAAGATGG - Intronic
1201856116 Y:18545106-18545128 ACATGGGTGTGGAGGAAAGAGGG - Intergenic
1201877205 Y:18775279-18775301 ACATGGGTGTGGAGGAAAGAGGG + Intronic