ID: 1107465385

View in Genome Browser
Species Human (GRCh38)
Location 13:40645261-40645283
Sequence TAGGACCTTTAAAATGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107465385_1107465388 -2 Left 1107465385 13:40645261-40645283 CCCTGCTCATTTTAAAGGTCCTA 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1107465388 13:40645282-40645304 TATTTACCAGAACACTATGAAGG 0: 1
1: 0
2: 1
3: 17
4: 167
1107465385_1107465390 12 Left 1107465385 13:40645261-40645283 CCCTGCTCATTTTAAAGGTCCTA 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1107465390 13:40645296-40645318 CTATGAAGGTAGTAAAACTATGG 0: 1
1: 0
2: 0
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107465385 Original CRISPR TAGGACCTTTAAAATGAGCA GGG (reversed) Intronic
905384825 1:37595356-37595378 TTTGACCTTTAAAATGAGAAAGG - Intronic
905607886 1:39319976-39319998 TAGGCCCTTTAAACTTAACATGG + Intronic
907490457 1:54805954-54805976 AAGGACCCTGAAAATGTGCACGG + Intergenic
907700460 1:56781833-56781855 TAGGACATTTTAAAGGAGAAAGG - Intronic
909473299 1:76053920-76053942 TAGGAAATTTAAAATAAGAATGG - Intergenic
910316336 1:85888174-85888196 CAGGACCTTTTTTATGAGCAGGG - Intronic
912583855 1:110743931-110743953 TAGCACCTTCAAAGAGAGCATGG + Intergenic
914437968 1:147677069-147677091 TAGTACCTTTGAAAACAGCATGG - Intergenic
918634291 1:186756277-186756299 TAGAGACTTTAAAAAGAGCAAGG - Intergenic
920554244 1:206892458-206892480 TGGGACCTTTAAAAGGCGAATGG - Intergenic
921168245 1:212523017-212523039 TAGAACCTTTAATTTAAGCAAGG + Intergenic
921631980 1:217444860-217444882 TAGTACCTTGAAAAGGAGCTTGG + Intronic
922066825 1:222152275-222152297 TAGGACCTTTAAAAGGTGACTGG + Intergenic
923891971 1:238226165-238226187 TAGTACCTTTAAAATAAGTGGGG - Intergenic
1063239552 10:4153787-4153809 TGAGGCCTTTAAAATGAGCAGGG - Intergenic
1063289171 10:4724051-4724073 AAGGACCTTAAAAATGTCCATGG - Intergenic
1064275159 10:13898877-13898899 TCTCACCTTTAAAATGAGCCTGG + Intronic
1065491677 10:26288564-26288586 AAGCAGCTTTAAAATGAGCAGGG + Intronic
1068646036 10:59469529-59469551 TAGGAACTTAAAGATAAGCAAGG + Intergenic
1069279418 10:66636260-66636282 TAGGCCCTTTAACGTTAGCAGGG + Intronic
1070367812 10:75753142-75753164 TAGGGCTTTAAAAATGAACAGGG - Intronic
1071584315 10:86804933-86804955 TGGTACCTTTAAAGGGAGCATGG - Intronic
1075939964 10:126382464-126382486 TAGGGCCTGTGAACTGAGCAGGG - Intronic
1076477857 10:130765096-130765118 TGGAGCCTTTAGAATGAGCATGG - Intergenic
1078172616 11:8940182-8940204 TAGGAGGTTTAAAATCAGCCTGG - Intergenic
1079945867 11:26739994-26740016 TAAGAGATTTAAAAAGAGCATGG + Intergenic
1084746575 11:71173912-71173934 TAGAGCCTTTGAAGTGAGCACGG + Intronic
1085365824 11:75943149-75943171 TAGCACCTATAAAATCATCATGG + Intronic
1086764941 11:90685028-90685050 TAGTACCTTGAAAATAAGTAGGG - Intergenic
1087686970 11:101275977-101275999 GAGCACCTTTGAAATGAGCAAGG + Intergenic
1087834949 11:102863966-102863988 TAGGAGAGTTAGAATGAGCAGGG - Intronic
1089437876 11:118486414-118486436 TACCACCTTTACAATGAGGAAGG + Intronic
1094226888 12:28056023-28056045 TAGGACATTGAAAATGCTCATGG - Intergenic
1097508280 12:60503969-60503991 AAGCAACTTTTAAATGAGCAAGG + Intergenic
1098393098 12:69990302-69990324 CAGGACCTGGAAAATGAGCAAGG - Intergenic
1101315892 12:103628546-103628568 TAGAAGCTTCAAAAGGAGCATGG - Intronic
1101644653 12:106620037-106620059 CAGGAACTTTAAAATAACCATGG - Intronic
1102586187 12:113924576-113924598 GAGAACCTTCAAAATGTGCAAGG + Intronic
1102725390 12:115059941-115059963 TAGGAAATTTAAAATAATCAAGG - Intergenic
1107465385 13:40645261-40645283 TAGGACCTTTAAAATGAGCAGGG - Intronic
1109408463 13:61933119-61933141 TATGAAGTTGAAAATGAGCATGG - Intergenic
1109664610 13:65516920-65516942 TAGGAAGTTTAAAATAAGTATGG - Intergenic
1111618244 13:90689695-90689717 TAGGGGCTTTAGAGTGAGCACGG - Intergenic
1111752785 13:92356088-92356110 TAGGACTTTGGAAACGAGCAGGG - Intronic
1112021233 13:95372963-95372985 AGGGACCTTAAAAATAAGCACGG + Intergenic
1114073822 14:19139434-19139456 TAGTAATTTTAAAATGAGGATGG - Intergenic
1114088443 14:19260551-19260573 TAGTAATTTTAAAATGAGGATGG + Intergenic
1114885512 14:26844869-26844891 TAGAATTTTTAACATGAGCAAGG - Intergenic
1117739647 14:58803809-58803831 TAGTCCCTTTCCAATGAGCAGGG - Intergenic
1122807207 14:104265897-104265919 TATGAGCTTATAAATGAGCAGGG - Intergenic
1125228378 15:37423011-37423033 TAGCACTTTTAAAATTAGGAAGG + Intergenic
1125999048 15:44192535-44192557 TAGGATCTTTTAAATCAGTATGG - Intronic
1127755576 15:62088716-62088738 TTGGATCTTTAAAATGTGCTTGG + Intergenic
1133802524 16:9095335-9095357 TAGAACCAATAAAATTAGCAAGG + Intronic
1137878753 16:52024222-52024244 TAGGACTCTGAAAATCAGCATGG - Intronic
1140266696 16:73427511-73427533 TAGAAGCTTGGAAATGAGCATGG - Intergenic
1141716743 16:85731296-85731318 TAAGAGCATTAAACTGAGCATGG + Intronic
1142844659 17:2663603-2663625 TAGAACCTTTAACTTCAGCAAGG - Intronic
1144526357 17:15993773-15993795 CAGGAACTGTAAAATGAGAATGG + Exonic
1147198124 17:38781273-38781295 TAGGACCTTGAGGAGGAGCAGGG - Intronic
1148032861 17:44634078-44634100 GAAGACCGTTAAAATCAGCAGGG + Intergenic
1149125975 17:53233491-53233513 TAGGATGTTACAAATGAGCAAGG + Intergenic
1149137565 17:53387601-53387623 TAGAACCTTTGAAGTGAGTAAGG - Intergenic
1149161103 17:53694192-53694214 TAATTCCTTTAAAATGTGCATGG - Intergenic
1149498368 17:57133333-57133355 TAGCGCTTTAAAAATGAGCATGG + Intergenic
1150206790 17:63415202-63415224 AAGGAACTTTGAAATGAGCATGG + Intronic
1150891125 17:69151281-69151303 TAGGACTTTAAGACTGAGCAGGG - Intronic
1151147431 17:72053952-72053974 TAAGATGTTTAAAATGATCATGG + Intergenic
1157137227 18:45068262-45068284 TTGTACATTTAAAATGAACATGG + Exonic
1157893061 18:51437340-51437362 TTTGACCTTTAAAAAGTGCAGGG + Intergenic
1161058931 19:2204776-2204798 GAGGACCTCAAACATGAGCAGGG - Intronic
1161822194 19:6536624-6536646 TGGAGCCTTTAGAATGAGCATGG - Intergenic
926081717 2:9992411-9992433 TAGAATCTTTTAAATGAGCTAGG - Intronic
926337666 2:11876378-11876400 TAGCCCCGTTAAAATGATCAAGG - Intergenic
928343352 2:30466186-30466208 GCGGAACTTTAAAATGAGCTTGG - Intronic
928640942 2:33298217-33298239 TTGGGTCTTTAAAATGACCAAGG - Intronic
928847293 2:35692287-35692309 TAATACATTAAAAATGAGCAAGG + Intergenic
928977086 2:37099096-37099118 TAGGACTTTGAAAATAAACATGG - Exonic
931443455 2:62307471-62307493 TAGGACTTTTATATTGAACATGG - Intergenic
936614137 2:114031728-114031750 CCGGACATTTAAAATGAACACGG - Intergenic
937632225 2:124115931-124115953 CAGGACTCTTAAAATAAGCATGG - Intronic
937955976 2:127422070-127422092 TAGGACCTGAAAATTGTGCACGG + Intronic
938225198 2:129609829-129609851 GAGGCCCTTTAACATGAGCAAGG - Intergenic
938487756 2:131730804-131730826 TAGTAATTTTAAAATGAGGATGG - Intronic
938826044 2:135006489-135006511 TACGACAATTAAAATGAACAAGG - Intronic
944644062 2:201760797-201760819 TAGAAACTTTAAAATGAGTAAGG - Intronic
947485072 2:230540574-230540596 TGGGAACTTGATAATGAGCACGG - Intronic
1168733617 20:110212-110234 CAGGACCTTTGAAATATGCAGGG + Intergenic
1169987782 20:11465136-11465158 TAGTATCATTAAAATGACCATGG - Intergenic
1172823599 20:37760757-37760779 TAGTACCTTTATAATGATAATGG - Intronic
1173302293 20:41814954-41814976 TAGCACCTTTAAAATTAGGGAGG - Intergenic
1173338126 20:42129878-42129900 CAGGACCTTTTAAAGGTGCAGGG - Intronic
1174315094 20:49693538-49693560 TAGGGCCTTTAGAAACAGCAAGG - Intronic
1180492270 22:15861786-15861808 TAGTAATTTTAAAATGAGGATGG - Intergenic
1180648261 22:17357670-17357692 TGCGACCTTTAAACTGAGTAGGG + Intergenic
1181423675 22:22819154-22819176 CAGCACCTGTAAAGTGAGCAAGG - Intronic
1181895120 22:26100368-26100390 ACTTACCTTTAAAATGAGCAAGG - Intergenic
950398491 3:12752454-12752476 TCTGACCTATAAAATGGGCACGG - Intronic
950670713 3:14523820-14523842 TTCGACCTGTAAAATGGGCAAGG - Intronic
951397420 3:22186171-22186193 TAGGAACTTCAAAATAAGAAAGG + Intronic
951694113 3:25428010-25428032 AAGTGCTTTTAAAATGAGCAGGG - Intronic
951810705 3:26695968-26695990 GAATACCTTTAAAATGAGAAAGG - Intronic
953938143 3:47064690-47064712 TAGAACCTTTAAAATTTGGAAGG - Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
956828888 3:73026126-73026148 TAAGAACTTTAACTTGAGCAAGG - Intronic
957143545 3:76392971-76392993 TAAGTTCTTTAAAATGTGCATGG - Intronic
959907936 3:111731205-111731227 TAGGGCCTCTAGAAGGAGCATGG - Intronic
962193317 3:133334048-133334070 TTGGACCTGCAAAATGAGGATGG - Intronic
963835333 3:150053099-150053121 AAGGACCTTAACAATGATCAAGG + Intergenic
965479491 3:169200095-169200117 TTTGACCTTTGAAATGAGGAAGG - Intronic
965986319 3:174757989-174758011 AAAGGCCTTTAAAATTAGCAAGG + Intronic
966038283 3:175447420-175447442 TAGGAGATTAAAAATGATCATGG - Intronic
967521238 3:190435408-190435430 TAGGGCCTTTAAAAAGACAAAGG - Intronic
967971760 3:195004624-195004646 TAGGACCTGCAAACTGAGCTGGG - Intergenic
970311154 4:14783868-14783890 TAGGACCTTCAAAAAGCACAGGG - Intergenic
972012638 4:34204242-34204264 TTGCATCTTTAAAATGTGCATGG + Intergenic
972208828 4:36812427-36812449 TAGGACATTTAAAATGCTAAAGG - Intergenic
975309972 4:72892799-72892821 TAGGATATTTAAGATGAGTAAGG - Intergenic
975351628 4:73353509-73353531 TAGAACCTTCAAAGAGAGCATGG + Intergenic
976079149 4:81335411-81335433 TAGGGTCTAAAAAATGAGCAAGG - Intergenic
976260330 4:83139275-83139297 TATGAGCTTAAGAATGAGCAAGG + Intergenic
976964271 4:91016391-91016413 TAGCATATTTAAAATGTGCAAGG - Intronic
977568963 4:98610518-98610540 TAGGCCCTTCATGATGAGCAGGG + Intronic
977920825 4:102640788-102640810 TAGAACCTTTAAATAGAGGAAGG + Intronic
978258655 4:106723288-106723310 TAAGACGTTTAAAAGCAGCATGG + Intergenic
980127861 4:128790670-128790692 TAGAACCTTTAGAGGGAGCACGG - Intergenic
980240693 4:130170786-130170808 TAAGACCTTTAGAATGTGGAGGG - Intergenic
980462568 4:133135550-133135572 AAGGACCTTGAAAAAGAACACGG + Intergenic
987023872 5:13903399-13903421 TAAGATATTTAAAATGAGAAAGG + Intronic
989344659 5:40416457-40416479 TAGAGCCTTCAAAAGGAGCAGGG + Intergenic
989393716 5:40929993-40930015 TATGGCCTTTGAAAGGAGCAAGG - Intronic
990149071 5:52796715-52796737 AAGGACCTTTAAAAGGACAAAGG + Intronic
990157399 5:52894294-52894316 GAAGACCTTTAAAATGGGCAAGG - Intronic
990948784 5:61276277-61276299 TAGGTGCTTTGAAATGAGGAAGG + Intergenic
991010841 5:61881600-61881622 TTTGACATTGAAAATGAGCAAGG - Intergenic
991452909 5:66771605-66771627 TAGAACCTAAGAAATGAGCAGGG - Intronic
992287035 5:75246665-75246687 TAGAACCTTCAGAAAGAGCATGG - Intergenic
997670424 5:135666807-135666829 TTGGCCCTCCAAAATGAGCAAGG - Intergenic
998281472 5:140812010-140812032 TTGGACTTTTAAAATGAGTTTGG + Intronic
1001885174 5:175283756-175283778 TAGGACCTTGAAAAAGAGCGTGG + Intergenic
1002017461 5:176336295-176336317 AAGGAACTTTAAAAAGTGCAGGG - Intronic
1002474641 5:179457376-179457398 TAGGACCTTCAGAAAGACCATGG + Intergenic
1004269904 6:14185722-14185744 TAGAACCTTTGAAGGGAGCATGG + Intergenic
1004846867 6:19653333-19653355 AATGCCCATTAAAATGAGCATGG - Intergenic
1008601128 6:53096485-53096507 CAGGACCTTCCAAATGAGCAGGG - Intronic
1010568991 6:77455002-77455024 TTGGAGATTTAAAATGAGGAGGG + Intergenic
1010609073 6:77930343-77930365 ATGAACCTTTAAAATGAGGAGGG + Intergenic
1011265560 6:85514346-85514368 TAGCAACTTTAATATGATCAAGG + Intronic
1011925868 6:92644490-92644512 TAGGACCATTAAAAAGACAAGGG + Intergenic
1013240340 6:108239338-108239360 TACCATCTTTAAAATGAGCCAGG + Intronic
1014353367 6:120372460-120372482 TAGGGCCTTTAAAATTTCCATGG - Intergenic
1015336630 6:132046616-132046638 TAGGACCTATAAATTGAGGCAGG + Intergenic
1015903391 6:138090633-138090655 TTGGACACCTAAAATGAGCAAGG + Exonic
1016193540 6:141301810-141301832 TAGGTCCTATAAATTGTGCAAGG + Intergenic
1016353063 6:143188726-143188748 TAGAATCTTTAAAATGAGAGTGG - Intronic
1016693114 6:146962124-146962146 CAGGGCCTATAAAATGAGAAGGG - Intergenic
1016895968 6:149053432-149053454 TATGACCCTGAACATGAGCATGG - Intronic
1017606049 6:156134304-156134326 TAGCACCTTTAAAGGAAGCATGG + Intergenic
1017777470 6:157691352-157691374 TCTGCCTTTTAAAATGAGCATGG + Intergenic
1018693714 6:166372499-166372521 TAGGACTTTTGAACTGAGCAGGG - Intronic
1018932349 6:168249615-168249637 TAGGGCCATTAAAATGGACAGGG - Intergenic
1019095206 6:169574210-169574232 GAGGACCCTCAAAATGAGTAAGG - Intronic
1019916681 7:4137626-4137648 TATGAGCATTAAAAGGAGCAAGG - Intronic
1021856107 7:24858140-24858162 AAGGACTTTTAAAACTAGCATGG + Intronic
1022841281 7:34166276-34166298 TAGAAACTTTTAAATGAGCATGG - Intergenic
1023728382 7:43167161-43167183 TAGGGCCTTTGAAGGGAGCATGG - Intronic
1030747238 7:113181739-113181761 AATGACCTTGAAAATGACCAAGG + Intergenic
1031939700 7:127775196-127775218 TAGAACCTTTAAAGGGAACATGG + Intronic
1036623208 8:10442378-10442400 TAGGACCTTCAGAGAGAGCATGG + Intergenic
1037268634 8:17099513-17099535 TGGGACTTTAAAACTGAGCAAGG - Intronic
1038313279 8:26462252-26462274 GAGGAGCTCAAAAATGAGCAAGG + Intronic
1039470672 8:37811805-37811827 TAGGAAATTTAAAATGGGCTGGG + Intronic
1043285225 8:78519631-78519653 GAGGACTTATAAAATGAACAGGG - Intronic
1048019450 8:130525046-130525068 TAGGACCTTTGGAGAGAGCATGG + Intergenic
1049115109 8:140679325-140679347 TAAACCTTTTAAAATGAGCATGG - Intronic
1051653863 9:19358982-19359004 TAGGAGCTATAAAATGATAATGG + Intronic
1052171830 9:25408508-25408530 TTGGATCTTTAAAACCAGCACGG - Intergenic
1052512783 9:29442506-29442528 TAGAATCTTTAAAATGACCTAGG + Intergenic
1057874808 9:98745904-98745926 GAAGACCCTTAAAATGAGCCAGG + Intronic
1058425134 9:104869344-104869366 TAGGAGCTGTCAACTGAGCAGGG + Intronic
1059459286 9:114419753-114419775 TAGGATCTGTAAAATGAGGATGG - Intronic
1062427835 9:136514158-136514180 TGGGACCATTTAAATCAGCAGGG - Intronic
1188536204 X:31199859-31199881 TAGGACCTTCAGAATGAGGCTGG - Intronic
1189199433 X:39179595-39179617 TTGGACTTATAAAATGAGCTGGG + Intergenic
1189687636 X:43582137-43582159 TATGAGCATGAAAATGAGCAAGG + Intergenic
1193356887 X:80530111-80530133 TAAGAACTTTATAATGAGCTTGG + Intergenic
1193414166 X:81201687-81201709 TAGGAATCTTAAAATGCGCAAGG + Intronic
1195135636 X:101905090-101905112 TTGGACCTGTAAAATGAGAGTGG - Intronic
1196963848 X:121033700-121033722 TAGAGCCTTTAGAAGGAGCATGG + Intergenic
1197690396 X:129494463-129494485 TAAGACCTTTAATATGAAAAGGG + Intronic