ID: 1107466125

View in Genome Browser
Species Human (GRCh38)
Location 13:40652261-40652283
Sequence AACCTACTGGTGTAACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107466119_1107466125 30 Left 1107466119 13:40652208-40652230 CCCACTTTCTCCTGTATTCAAAT 0: 1
1: 0
2: 1
3: 21
4: 390
Right 1107466125 13:40652261-40652283 AACCTACTGGTGTAACAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 90
1107466121_1107466125 20 Left 1107466121 13:40652218-40652240 CCTGTATTCAAATCACAGTATAG 0: 1
1: 1
2: 1
3: 12
4: 173
Right 1107466125 13:40652261-40652283 AACCTACTGGTGTAACAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 90
1107466120_1107466125 29 Left 1107466120 13:40652209-40652231 CCACTTTCTCCTGTATTCAAATC 0: 1
1: 0
2: 0
3: 35
4: 588
Right 1107466125 13:40652261-40652283 AACCTACTGGTGTAACAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107466125 Original CRISPR AACCTACTGGTGTAACAAAC TGG Intronic
903740171 1:25554137-25554159 ACCCAACTGGAGTAACAAGCTGG - Intronic
904512563 1:31024812-31024834 AACCTAAAGGTGGAGCAAACAGG + Intronic
911313522 1:96327268-96327290 ATTGTACTGCTGTAACAAACAGG + Intergenic
911415096 1:97561923-97561945 AAATTTCTGGTGTAACATACAGG - Intronic
914955629 1:152159409-152159431 CACCTACTGTAGTGACAAACAGG - Intergenic
915001551 1:152598567-152598589 AAACTACTGGAGTAAAACACAGG + Intronic
917289592 1:173459417-173459439 AACTTACTGATAAAACAAACTGG - Intergenic
917528227 1:175808634-175808656 AACCTTTTGCTGTAATAAACTGG - Intergenic
917560304 1:176145335-176145357 AATCTACTGGTATCACATACTGG + Intronic
924037042 1:239948398-239948420 AATTTACCTGTGTAACAAACCGG + Intergenic
1064243356 10:13650243-13650265 AACCAACTGGTGGCACATACTGG + Intronic
1066982020 10:42425232-42425254 AACCTACTGTATTAAAAAACAGG + Intergenic
1068461822 10:57339228-57339250 AATCCATTGGTGTAACTAACAGG - Intergenic
1068857260 10:61810397-61810419 AACCTCCTTGTTTTACAAACAGG + Intergenic
1069731814 10:70621582-70621604 AACCTACTCTTGTAACAAGTAGG + Intergenic
1075596181 10:123731001-123731023 AACCCACTGCTTTCACAAACAGG + Intronic
1076065145 10:127442532-127442554 AACTTACTGATGGAACAAACAGG + Intronic
1080917284 11:36673043-36673065 AATCCATTGGTGTAACTAACAGG + Intergenic
1087915779 11:103809007-103809029 AAGCTACTGGTGTTACAATTAGG - Intergenic
1091407616 12:219060-219082 CACCTATTGGTGTAAGAACCCGG - Intergenic
1096953583 12:55502293-55502315 AATTTACTTATGTAACAAACCGG + Intergenic
1101975134 12:109350956-109350978 AATCTACAGATGTAACAAAATGG - Intronic
1105924719 13:24997587-24997609 AATCCATTGGTGTAACTAACAGG + Intergenic
1106537555 13:30660607-30660629 ACTCTACCGGTGTAACAAACAGG - Intronic
1107466125 13:40652261-40652283 AACCTACTGGTGTAACAAACTGG + Intronic
1108357061 13:49637475-49637497 ACCCTACTGATCTATCAAACAGG - Intergenic
1116180826 14:41531357-41531379 AACTCACTGGTGAAACAAACAGG + Intergenic
1119842044 14:77800412-77800434 AGCCCACTGGTGTGCCAAACTGG - Intronic
1120671668 14:87369425-87369447 AAACTATTGGGTTAACAAACTGG - Intergenic
1126714923 15:51505306-51505328 GACCTACTGCTGTCACAAACAGG + Intronic
1127673421 15:61217342-61217364 GACTGACTGCTGTAACAAACAGG + Intronic
1128778287 15:70340712-70340734 CATCTACTGATGTAACTAACAGG + Intergenic
1129976181 15:79823761-79823783 ATCCATCTGCTGTAACAAACTGG + Intergenic
1141707220 16:85673242-85673264 AACCCACTGTAGTAACAATCTGG - Exonic
1142603380 17:1068398-1068420 AGCCTGGTGGTGTAACACACTGG + Intronic
1143441428 17:6977495-6977517 AACCTAATTTTGTAACAAACTGG + Intronic
1146908802 17:36634720-36634742 AACGTACTCGTGGAACATACAGG - Intergenic
1150937052 17:69648069-69648091 AACTTACTCGTTTAACAATCTGG + Intergenic
1155882434 18:31166252-31166274 AAACTACAGGTGTAAAAAAAGGG + Intergenic
1158711113 18:59839001-59839023 CACCTACTAGTTTAAAAAACTGG - Intergenic
1159324767 18:66900621-66900643 AAGCTACTGGAGCAATAAACTGG - Intergenic
1160527620 18:79546763-79546785 AACTTGCTGGTGTAACTCACTGG + Intergenic
1161313017 19:3605040-3605062 ACCCTGTTGGTGTCACAAACAGG - Intronic
1164912447 19:32023829-32023851 AATATACTCGTGTAATAAACAGG - Intergenic
1168617661 19:57851518-57851540 ATCCCACTGGTGTCAGAAACAGG - Intronic
925042743 2:746194-746216 AAACTACCGGTGGAACAAAAAGG + Intergenic
925732107 2:6926568-6926590 AACCTATTGATGGAACACACAGG - Intronic
930215815 2:48695958-48695980 AATATACTCATGTAACAAACTGG + Intronic
930583816 2:53246184-53246206 AATCTACCCATGTAACAAACTGG + Intergenic
930950759 2:57141836-57141858 AACATACTGGAACAACAAACAGG - Intergenic
941126154 2:161585954-161585976 AATATACTTATGTAACAAACAGG - Intronic
1170611322 20:17916037-17916059 AACCTCCTGGTAGAAGAAACTGG - Intergenic
949929239 3:9065343-9065365 AACCTTCTAGTTTGACAAACAGG + Intronic
950262814 3:11554597-11554619 AACCACCTGGTGGAACCAACAGG - Intronic
953635202 3:44657549-44657571 AACCTAATGGTGTCAAAAAGGGG - Intronic
955095137 3:55789777-55789799 AGCCTACTGGTGATACAAAAAGG + Intronic
966945905 3:184776975-184776997 GACCTACTGGTCTAACACACTGG - Intergenic
968843449 4:3025327-3025349 AACCTAATGGTGTATCCAGCTGG - Intronic
970291962 4:14582572-14582594 AAACTACTGGTGTAATAAAAAGG + Intergenic
974666181 4:64964747-64964769 AATTTACCTGTGTAACAAACTGG - Intergenic
976129898 4:81872462-81872484 AGCCAACTGGAGTAACAAACTGG + Intronic
980623198 4:135337218-135337240 AACCTACTGGTTAACCTAACTGG - Intergenic
980724148 4:136736199-136736221 AAACTACTGGTGAAATCAACTGG - Intergenic
981884075 4:149651616-149651638 AAACTACTGCAGTAACAAAATGG + Intergenic
982919221 4:161252692-161252714 AATCCACTGGTATAACTAACAGG - Intergenic
984124330 4:175787500-175787522 AACCTAAAGGTGGAACAAAAAGG - Intronic
984760369 4:183357863-183357885 CCCCTAAAGGTGTAACAAACCGG + Intergenic
985689411 5:1298858-1298880 AACAAACTGGTTAAACAAACGGG - Intergenic
987296283 5:16554826-16554848 AACTTACTGGTATAACACAATGG + Intronic
990173397 5:53080583-53080605 AACCCACTGATGTACCTAACTGG + Exonic
992531870 5:77659813-77659835 GACCTACTGAGATAACAAACGGG - Intergenic
996637780 5:125715422-125715444 GTGCTACTGGTGTAACAAATTGG + Intergenic
998314072 5:141164160-141164182 TACCTACAGGTGAAGCAAACAGG - Intergenic
999539418 5:152555393-152555415 AATATACTCATGTAACAAACCGG + Intergenic
1005931371 6:30487276-30487298 AACATACCCATGTAACAAACCGG + Intergenic
1006545228 6:34775258-34775280 AGCCTAGTTATGTAACAAACAGG - Intergenic
1009527212 6:64762789-64762811 AACATAGTGGTGTATAAAACAGG - Intronic
1011198865 6:84812469-84812491 AACCTACACTTGCAACAAACAGG - Intergenic
1014033235 6:116733944-116733966 AACCTACAGCTGTAAAATACAGG + Exonic
1016612903 6:146012823-146012845 AACCTACTCGAGAAACAATCAGG - Intergenic
1017621647 6:156305312-156305334 AACCTGCTGATGTAACACAGAGG - Intergenic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1018956004 6:168410951-168410973 GACCTACTGGTGGAACTTACTGG - Intergenic
1021834916 7:24660624-24660646 AACCTAATTGTTTAACAAAAAGG - Intronic
1030622013 7:111800548-111800570 AATCCACTGGTGTAACAAACAGG + Intronic
1041761292 8:61369681-61369703 ACCCTACAAGTGTAAGAAACAGG + Intronic
1042293045 8:67189722-67189744 AACTTATTGGTGTAGCAAAGAGG + Intronic
1043921164 8:85984900-85984922 AATGCACTGGAGTAACAAACAGG + Intergenic
1046142697 8:110115837-110115859 CACCTACTGGTGGAACAACCTGG + Intergenic
1055183878 9:73426408-73426430 AAGCTACTGCTCTAACAAATGGG - Intergenic
1185727355 X:2432823-2432845 AAACTACTTGTTTAAAAAACAGG + Intronic
1187225496 X:17372486-17372508 AACAATCTGGTGTAACAATCAGG + Intergenic
1189198767 X:39174117-39174139 AACTTAATGGTGTAACATAGTGG + Intergenic
1190516517 X:51229162-51229184 AATCTACCCATGTAACAAACAGG - Intergenic
1194105017 X:89757926-89757948 AATCCATTGGTGTAACTAACAGG - Intergenic
1194122185 X:89975187-89975209 AACATACTGTTGTAACATACTGG + Intergenic
1194769710 X:97886726-97886748 TACCTACTGGGGAAACAAATGGG - Intergenic
1195566803 X:106348186-106348208 AAACAATTGGTGTCACAAACAGG - Intergenic
1196316998 X:114238740-114238762 ACCCTACAGGTTTAAGAAACTGG - Intergenic
1197532138 X:127642556-127642578 AATATACCCGTGTAACAAACAGG - Intergenic
1198123060 X:133613314-133613336 AACCTATTTTTGTAACAATCTGG + Intronic
1200475039 Y:3632621-3632643 AACATACTGTTGTTACATACTGG + Intergenic