ID: 1107468183

View in Genome Browser
Species Human (GRCh38)
Location 13:40667290-40667312
Sequence TGCAGTCGAGTCCGCGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 7}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107468176_1107468183 -4 Left 1107468176 13:40667271-40667293 CCCCCGGCGCCGCGGCTCCTGCA 0: 1
1: 0
2: 3
3: 57
4: 394
Right 1107468183 13:40667290-40667312 TGCAGTCGAGTCCGCGCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 7
1107468167_1107468183 22 Left 1107468167 13:40667245-40667267 CCCTCGCGAGCGGCACACGCCCC 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1107468183 13:40667290-40667312 TGCAGTCGAGTCCGCGCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 7
1107468174_1107468183 0 Left 1107468174 13:40667267-40667289 CCCACCCCCGGCGCCGCGGCTCC 0: 1
1: 1
2: 1
3: 52
4: 446
Right 1107468183 13:40667290-40667312 TGCAGTCGAGTCCGCGCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 7
1107468165_1107468183 24 Left 1107468165 13:40667243-40667265 CCCCCTCGCGAGCGGCACACGCC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1107468183 13:40667290-40667312 TGCAGTCGAGTCCGCGCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 7
1107468172_1107468183 2 Left 1107468172 13:40667265-40667287 CCCCCACCCCCGGCGCCGCGGCT 0: 1
1: 2
2: 13
3: 80
4: 931
Right 1107468183 13:40667290-40667312 TGCAGTCGAGTCCGCGCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 7
1107468166_1107468183 23 Left 1107468166 13:40667244-40667266 CCCCTCGCGAGCGGCACACGCCC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1107468183 13:40667290-40667312 TGCAGTCGAGTCCGCGCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 7
1107468173_1107468183 1 Left 1107468173 13:40667266-40667288 CCCCACCCCCGGCGCCGCGGCTC 0: 1
1: 1
2: 5
3: 63
4: 466
Right 1107468183 13:40667290-40667312 TGCAGTCGAGTCCGCGCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 7
1107468178_1107468183 -6 Left 1107468178 13:40667273-40667295 CCCGGCGCCGCGGCTCCTGCAGT 0: 1
1: 0
2: 0
3: 32
4: 300
Right 1107468183 13:40667290-40667312 TGCAGTCGAGTCCGCGCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 7
1107468179_1107468183 -7 Left 1107468179 13:40667274-40667296 CCGGCGCCGCGGCTCCTGCAGTC 0: 1
1: 0
2: 0
3: 21
4: 194
Right 1107468183 13:40667290-40667312 TGCAGTCGAGTCCGCGCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 7
1107468177_1107468183 -5 Left 1107468177 13:40667272-40667294 CCCCGGCGCCGCGGCTCCTGCAG 0: 1
1: 0
2: 5
3: 21
4: 275
Right 1107468183 13:40667290-40667312 TGCAGTCGAGTCCGCGCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 7
1107468164_1107468183 28 Left 1107468164 13:40667239-40667261 CCGGCCCCCTCGCGAGCGGCACA 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1107468183 13:40667290-40667312 TGCAGTCGAGTCCGCGCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 7
1107468168_1107468183 21 Left 1107468168 13:40667246-40667268 CCTCGCGAGCGGCACACGCCCCC 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1107468183 13:40667290-40667312 TGCAGTCGAGTCCGCGCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 7
1107468171_1107468183 3 Left 1107468171 13:40667264-40667286 CCCCCCACCCCCGGCGCCGCGGC 0: 1
1: 1
2: 15
3: 124
4: 916
Right 1107468183 13:40667290-40667312 TGCAGTCGAGTCCGCGCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 7
1107468175_1107468183 -1 Left 1107468175 13:40667268-40667290 CCACCCCCGGCGCCGCGGCTCCT 0: 1
1: 1
2: 6
3: 104
4: 782
Right 1107468183 13:40667290-40667312 TGCAGTCGAGTCCGCGCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107468183 Original CRISPR TGCAGTCGAGTCCGCGCCGA GGG Intergenic