ID: 1107473538

View in Genome Browser
Species Human (GRCh38)
Location 13:40713148-40713170
Sequence GAGGGTGAGCAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107473538_1107473548 23 Left 1107473538 13:40713148-40713170 CCATCCTGCTTCTGCTCACCCTC No data
Right 1107473548 13:40713194-40713216 CCAGTCCCAATGAGATGAGCCGG 0: 109
1: 348
2: 415
3: 240
4: 289
1107473538_1107473549 24 Left 1107473538 13:40713148-40713170 CCATCCTGCTTCTGCTCACCCTC No data
Right 1107473549 13:40713195-40713217 CAGTCCCAATGAGATGAGCCGGG 0: 115
1: 648
2: 1025
3: 746
4: 892

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107473538 Original CRISPR GAGGGTGAGCAGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr