ID: 1107475768

View in Genome Browser
Species Human (GRCh38)
Location 13:40734305-40734327
Sequence GACTTCTGTCCCTTCTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107475768_1107475775 1 Left 1107475768 13:40734305-40734327 CCAACATAGAAGGGACAGAAGTC 0: 1
1: 1
2: 1
3: 9
4: 147
Right 1107475775 13:40734329-40734351 CAGGAGGAGGGCAAAATGATAGG 0: 2
1: 0
2: 4
3: 18
4: 272
1107475768_1107475776 27 Left 1107475768 13:40734305-40734327 CCAACATAGAAGGGACAGAAGTC 0: 1
1: 1
2: 1
3: 9
4: 147
Right 1107475776 13:40734355-40734377 ACAGTTGTGCCAGAAGACCTAGG 0: 1
1: 0
2: 1
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107475768 Original CRISPR GACTTCTGTCCCTTCTATGT TGG (reversed) Intronic
907282829 1:53362197-53362219 GAATTCTGCCCTTTCTTTGTGGG - Intergenic
917483229 1:175431496-175431518 CTCTTCTCTCCCTTCTATGGGGG + Intronic
922768230 1:228166848-228166870 GCCTGCTGTCCCTGCTATGGCGG + Intronic
922972405 1:229753960-229753982 GCCTTCTCTCCCTGCTATCTGGG - Intergenic
923630405 1:235645896-235645918 GTCTTCTGTCCCCTCCATATGGG - Intronic
923696364 1:236256048-236256070 GAGTGCTGTCCCTTCTGTTTAGG - Intronic
923696545 1:236257491-236257513 GAATGCTGTCCCTTCTGTTTAGG - Intronic
1065330409 10:24591244-24591266 GACTCCTGTCCTTCCAATGTTGG + Exonic
1065818841 10:29506812-29506834 GGCCTCTGTCCCTTCCCTGTAGG - Intronic
1068545153 10:58335795-58335817 GGCTCCTGCCCCTTCTATTTTGG + Intronic
1068646867 10:59477895-59477917 GCCTTCAGTCCCATCTATGAGGG - Intergenic
1071473762 10:86007192-86007214 GTCTTCTTTCCCTTTTATGATGG - Intronic
1071486306 10:86104719-86104741 TGCCTCTGTCCCTTCAATGTTGG + Intronic
1071747951 10:88443168-88443190 GACTTTTGTCCCTTTTAATTTGG + Intronic
1078165613 11:8881366-8881388 AACTCCTGTGACTTCTATGTTGG + Intronic
1080104135 11:28494207-28494229 GCCTTCTCTCCCTGCTCTGTGGG - Intergenic
1081538660 11:44014384-44014406 GACCTCAGTCCCTGCCATGTGGG + Intergenic
1082797699 11:57389909-57389931 TACTTCTGGCTCTTCTATTTGGG - Exonic
1083058088 11:59842442-59842464 AACTCCTCTCCCTTCAATGTAGG - Exonic
1085531736 11:77195726-77195748 CACAACTGTCCATTCTATGTGGG - Intronic
1087089583 11:94254796-94254818 GACTTCTGGACCTTGTGTGTTGG - Intergenic
1088384439 11:109237691-109237713 GATTTCTGACCCTTCTCTTTAGG + Intergenic
1088951857 11:114579735-114579757 GACTTCTCTACCTCCTATCTGGG - Intronic
1089220839 11:116870162-116870184 GTCTTCTGTTACTTCCATGTGGG + Intronic
1091638866 12:2219124-2219146 AACTGCTGTCCCTTTTATGATGG + Intronic
1099578452 12:84409191-84409213 GAAGTGTGTCCCTTCTAAGTGGG - Intergenic
1099832958 12:87868775-87868797 GACTTTTTTCTCTTCTACGTTGG + Intergenic
1105516128 13:21092395-21092417 GACTTGTGTCCCTTTCATGAAGG + Intergenic
1107475768 13:40734305-40734327 GACTTCTGTCCCTTCTATGTTGG - Intronic
1108406206 13:50104979-50105001 GACTGCTTTCCCTTCTCTGTTGG - Exonic
1111815392 13:93146766-93146788 GACGTCTGTCTCTTCTATCCAGG + Intergenic
1113319552 13:109220639-109220661 AACTTCTGTCCTTTCCATGATGG + Intergenic
1113455933 13:110449011-110449033 GCCTTCTGTCCCTTGCACGTGGG + Intronic
1114991371 14:28294242-28294264 GACTGTTGGCCTTTCTATGTAGG + Intergenic
1115523232 14:34253678-34253700 GACTTCTGTATCTTCTATTTTGG - Intronic
1116784716 14:49275014-49275036 GACTTCTATATCTGCTATGTAGG - Intergenic
1117732008 14:58732545-58732567 GACTCCTTTTTCTTCTATGTTGG + Intergenic
1120750570 14:88193915-88193937 GTCCTCTGTCCCTTCTGTGAAGG + Intronic
1121890042 14:97581411-97581433 GACATGTGCCCCTTCTGTGTTGG + Intergenic
1122692769 14:103539031-103539053 GACATCTGTCCCTTCAAAGAGGG + Intergenic
1124591948 15:31061399-31061421 GACTCCTGTCCCTCTGATGTTGG - Intronic
1125397734 15:39268810-39268832 GTCTTCTATCCCTTTTTTGTAGG + Intergenic
1127387224 15:58476379-58476401 GACTTCTGTCCCTTAGAGGATGG - Intronic
1129928371 15:79385800-79385822 GAGCTCTGCCCCTTCTAAGTTGG - Intronic
1130140559 15:81222552-81222574 GAGTTCTGTACCTTCTGTGTTGG + Intronic
1131048117 15:89328971-89328993 GACTTCTGGCCTTGCTTTGTGGG + Exonic
1132408440 15:101559428-101559450 GTCTTCAGTTCCTTGTATGTTGG + Intergenic
1136710156 16:32230205-32230227 GACTTCTATCCCATCTCAGTGGG - Intergenic
1136757753 16:32699206-32699228 GACTTCTATCCCATCTCAGTGGG + Intergenic
1136810353 16:33171169-33171191 GACTTCTATCCCATCTCAGTGGG - Intergenic
1136816829 16:33281249-33281271 GACTTCTATCCCATCTCAGTGGG - Intronic
1137312351 16:47276691-47276713 TATTTCTGTGCCTTCTATTTTGG - Intronic
1137454167 16:48605541-48605563 GACTTCTTTCCCCTCTCTCTGGG + Intronic
1139935646 16:70569021-70569043 GACTTGTGTCACTTCCTTGTAGG + Exonic
1142064726 16:88054761-88054783 GGCTTCTGTCCTTACTATGTAGG + Intronic
1203059903 16_KI270728v1_random:959555-959577 GACTTCTATCCCATCTCAGTGGG + Intergenic
1144364042 17:14524986-14525008 GATTTGTGTCCCTTTAATGTTGG + Intergenic
1146033368 17:29385602-29385624 GACCTCTGTCCCTTCTTCGGGGG - Intergenic
1146628647 17:34454336-34454358 GCCCTCTCTCCCTTCTGTGTGGG - Intergenic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1149630294 17:58116409-58116431 GACGTCTGTCACATCTAGGTGGG + Intergenic
1149737750 17:59012268-59012290 GAATTCTGTCCCTTTTTTGGTGG - Intronic
1155071236 18:22318236-22318258 GACTTCATTCCCTTCTATCAGGG + Intergenic
1155434858 18:25801691-25801713 GACTTCTCTCTCTTCTGTGTTGG - Intergenic
1159688593 18:71456967-71456989 CACGTCTGTCCCTTGTATATAGG + Intergenic
1159709708 18:71741624-71741646 CCATTCTGTCCCTTCTAAGTGGG - Intronic
1163190887 19:15675680-15675702 GACTTCTGCTCCTTCTCTCTTGG - Intronic
925146444 2:1586174-1586196 GATTTCTGTTCCTTCCATGGTGG - Intergenic
925166894 2:1721274-1721296 GAATTCTGACACTTCTAAGTTGG - Intronic
929971798 2:46585500-46585522 TACTTCTGTCCCTGTTCTGTAGG - Intronic
930159704 2:48142298-48142320 GAGATATGTCCCTTCTATGCTGG + Intergenic
930225311 2:48786278-48786300 AACTTTTGTCCCTTCTCTGATGG + Intergenic
930422896 2:51176586-51176608 GGCTTCTGTGGCTTCTATGCTGG - Intergenic
931896486 2:66736724-66736746 GACTTCTATGCCTACTATGCAGG + Intergenic
931938668 2:67228163-67228185 GATTTCTCTCACTTCTAGGTGGG - Intergenic
934029482 2:88029500-88029522 GAGTTCTGTATCTTCTGTGTAGG + Intronic
936225014 2:110640878-110640900 GAATTCTATCCCTGCCATGTTGG + Intronic
937185572 2:120037836-120037858 GACTTCTTTCTTTTCCATGTGGG - Intronic
937320175 2:120956322-120956344 GACTTCCCTCCCTTCCATGAGGG - Intronic
941352453 2:164453450-164453472 GACTTTATTCCCATCTATGTTGG - Intergenic
941837169 2:170036669-170036691 GACCTCTGTCCATTTTCTGTTGG + Intronic
943049939 2:182902113-182902135 ATCTTCTGCCCCTTCTATGTTGG + Intergenic
1170445195 20:16419214-16419236 GACATCTGTCACTTGTATATGGG - Intronic
1171565949 20:26187665-26187687 GACTTCTGTTCACACTATGTGGG + Intergenic
1172756558 20:37289525-37289547 GACTTTTGTCCCTGTTCTGTGGG - Intergenic
1177522917 21:22253307-22253329 CCCTCCTGTCCCTGCTATGTGGG - Intergenic
1179801003 21:43811454-43811476 CACTTCTGACCCTTCTCTTTGGG + Intergenic
1181924767 22:26349111-26349133 GAATTGGGCCCCTTCTATGTGGG + Intronic
1184049777 22:41995995-41996017 GACTTCTCTCCCTTCTAAGCAGG + Intronic
950026821 3:9825793-9825815 GAGTTCTGCCCCTTCGCTGTGGG - Exonic
951821456 3:26818014-26818036 GACGTCTGTCTCCTCTCTGTTGG + Intergenic
954763445 3:52894424-52894446 GACTTCTTGCCTTACTATGTAGG - Intronic
955801813 3:62694531-62694553 GATTTCTGTCCCTTCTATGATGG - Intronic
958153418 3:89721375-89721397 CACTTATGACCCTTCTATTTTGG - Intergenic
959007500 3:101036947-101036969 GACTTCTCTTCCTTCTATTGCGG - Intergenic
962469948 3:135697780-135697802 AAATTCTGTCACTTCCATGTAGG - Intergenic
964302891 3:155309179-155309201 GACTTTTGTTTCCTCTATGTTGG + Intergenic
965780156 3:172277455-172277477 GACATCAGTCCCATCTATGAGGG + Intronic
967954540 3:194868278-194868300 GGATTCTGTTCCTTCTCTGTAGG + Intergenic
970019606 4:11552933-11552955 TACTTCTTTCTCTTCAATGTGGG + Intergenic
971784844 4:31086982-31087004 GGCTTCTGTCCCTGCTGTTTGGG - Intronic
971924554 4:32990507-32990529 AACTTCTGCACCTTGTATGTCGG - Intergenic
972029424 4:34434636-34434658 GACTTCTGTTCACACTATGTGGG + Intergenic
973319168 4:48792814-48792836 GACTTCTGCCTCTGCTATCTTGG - Intergenic
981674181 4:147322204-147322226 GTCTTCTTTCCCTTCTATTACGG - Intergenic
982463314 4:155698531-155698553 GAATCCTGTCCTTACTATGTTGG + Intronic
983280506 4:165675450-165675472 GACTTCTTTCTCTTTCATGTCGG + Intergenic
985490822 5:177874-177896 GACTTTCGTCCCTTTTCTGTTGG + Intronic
992521616 5:77557413-77557435 GTCTTCTGTCCATTCTCTATTGG - Intronic
992640798 5:78766998-78767020 GCCTTCTGGCCCTTCTACTTGGG - Intronic
993018328 5:82562626-82562648 TACTTCTCTCCATTCTCTGTGGG - Intergenic
994920332 5:106034544-106034566 GACTTCTTTCCCTTTTCTTTTGG + Intergenic
999451838 5:151684452-151684474 GACTGTTGTGCCCTCTATGTAGG - Intronic
1001689405 5:173621708-173621730 GACTTGTGTCACTTCTAGGCCGG + Intergenic
1002440989 5:179264373-179264395 GACATCTGTGCCTTGGATGTAGG - Intronic
1006518906 6:34560254-34560276 GACTTGAGTCCCTCCTATTTTGG + Intergenic
1007903033 6:45429746-45429768 GACTTCTGTCTCTGCGAAGTGGG + Intronic
1009670071 6:66737452-66737474 TAGTTCTGTCCGTTCTGTGTTGG + Intergenic
1010791092 6:80066029-80066051 GACTCCTGTCCTTCCAATGTTGG + Intergenic
1011336097 6:86261261-86261283 AACTTCTGTTCCTTCTCTGAGGG + Intergenic
1011453334 6:87519064-87519086 GATTTCTTTCCCTTTAATGTAGG - Intronic
1011547825 6:88500166-88500188 GACTTCTGCTACTTCTATGATGG - Intergenic
1012195016 6:96330727-96330749 GACTTCTGAGCCTTCTCTGAAGG + Intergenic
1014549875 6:122778440-122778462 GCCTTCTGAGCCTTCTCTGTTGG + Intergenic
1015653143 6:135485616-135485638 GACTTTTGTAGTTTCTATGTAGG + Intronic
1016243140 6:141954865-141954887 GCCTTCTGTCTCACCTATGTGGG - Intergenic
1018334090 6:162765499-162765521 GACCTGTGTCCATTCCATGTGGG + Intronic
1018378390 6:163234601-163234623 GCCGTCTGTCCCTTAAATGTAGG - Intronic
1018927254 6:168215041-168215063 GGCCTCTGTCCCTTCAATGCAGG + Intergenic
1022562132 7:31360591-31360613 GACTTGTGTCCTTTGAATGTGGG + Intergenic
1026366415 7:69653080-69653102 CACTTCAGTCCCTTCAATGCAGG - Intronic
1026808170 7:73440895-73440917 GTCTTCTTTCCCTTTTATGATGG - Exonic
1028609064 7:92688489-92688511 GACTTTTGTCCCTTCTATGTCGG + Intronic
1029186449 7:98742183-98742205 GGCTTCCGTCCCATCCATGTGGG - Intergenic
1030883133 7:114905516-114905538 AACTTCTGCCCTTTCCATGTTGG + Intergenic
1030894951 7:115047669-115047691 CACTTCTGTCCTGTGTATGTGGG + Intergenic
1031336056 7:120534126-120534148 CACTTCTGCCCCTTGAATGTAGG + Intronic
1031363286 7:120872737-120872759 AAATTCTATCCCTTCTAGGTGGG + Intergenic
1031453996 7:121957166-121957188 ACCTTCTGTCCCTTCTTTGCAGG + Intronic
1033128984 7:138729412-138729434 GACTTTCATCCCTTCCATGTGGG + Intronic
1033164355 7:139026726-139026748 GGCTTCTGTCCCTGCTCAGTCGG - Exonic
1034401594 7:150865021-150865043 TCCCTCTGTCCCTTCAATGTAGG + Intergenic
1037428551 8:18784753-18784775 GGCTTCTGTCCCTGTGATGTTGG + Intronic
1038540009 8:28384524-28384546 TCCTTCTGTCCCCTCTATGAGGG + Intronic
1039990997 8:42487506-42487528 GCTTTCTGCCCCTTCTCTGTCGG + Intronic
1040687359 8:49890875-49890897 GTCTTCTGTCCCTCCAATCTGGG - Intergenic
1041224134 8:55681937-55681959 GACTGCTGTCCATTCTGGGTAGG - Intergenic
1042956944 8:74260815-74260837 GACTCCTTTCACTTCTATTTAGG + Intronic
1043064169 8:75545339-75545361 GACTTCTGTCCTTTCTTTATGGG + Intronic
1048799604 8:138183929-138183951 GAACTCAGTCCCTTCTATGCAGG + Intronic
1055667995 9:78571251-78571273 GACTTCTGTTCCTTTTAGTTTGG - Intergenic
1058356305 9:104087393-104087415 GACTTCTGTGCATTCTATTTTGG - Intergenic
1059183019 9:112237846-112237868 GACTTTTCTCCCTTCTCTGCTGG - Intronic
1060806700 9:126582208-126582230 CACTGCTGTCCCTTTTATTTTGG + Intergenic
1187036780 X:15549066-15549088 GACTTCTGTCACTTACAGGTGGG - Intronic
1190740387 X:53284667-53284689 GCCTGCTGCCCCTTCTCTGTCGG + Intronic
1194477605 X:94378319-94378341 GACTTCTGTCCCTTGTCAATGGG - Intergenic
1201529523 Y:14976876-14976898 AACTTCTGCCCTTTCTATGATGG + Intergenic
1201918187 Y:19205150-19205172 TACTTCAGTCCCTGCTATGAAGG - Intergenic