ID: 1107475775 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:40734329-40734351 |
Sequence | CAGGAGGAGGGCAAAATGAT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 296 | |||
Summary | {0: 2, 1: 0, 2: 4, 3: 18, 4: 272} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1107475765_1107475775 | 18 | Left | 1107475765 | 13:40734288-40734310 | CCAAAAAGAAAGGGTATCCAACA | 0: 1 1: 0 2: 2 3: 18 4: 175 |
||
Right | 1107475775 | 13:40734329-40734351 | CAGGAGGAGGGCAAAATGATAGG | 0: 2 1: 0 2: 4 3: 18 4: 272 |
||||
1107475768_1107475775 | 1 | Left | 1107475768 | 13:40734305-40734327 | CCAACATAGAAGGGACAGAAGTC | 0: 1 1: 1 2: 1 3: 9 4: 147 |
||
Right | 1107475775 | 13:40734329-40734351 | CAGGAGGAGGGCAAAATGATAGG | 0: 2 1: 0 2: 4 3: 18 4: 272 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1107475775 | Original CRISPR | CAGGAGGAGGGCAAAATGAT AGG | Intronic | ||