ID: 1107475775

View in Genome Browser
Species Human (GRCh38)
Location 13:40734329-40734351
Sequence CAGGAGGAGGGCAAAATGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 2, 1: 0, 2: 4, 3: 18, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107475765_1107475775 18 Left 1107475765 13:40734288-40734310 CCAAAAAGAAAGGGTATCCAACA 0: 1
1: 0
2: 2
3: 18
4: 175
Right 1107475775 13:40734329-40734351 CAGGAGGAGGGCAAAATGATAGG 0: 2
1: 0
2: 4
3: 18
4: 272
1107475768_1107475775 1 Left 1107475768 13:40734305-40734327 CCAACATAGAAGGGACAGAAGTC 0: 1
1: 1
2: 1
3: 9
4: 147
Right 1107475775 13:40734329-40734351 CAGGAGGAGGGCAAAATGATAGG 0: 2
1: 0
2: 4
3: 18
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107475775 Original CRISPR CAGGAGGAGGGCAAAATGAT AGG Intronic