ID: 1107475776

View in Genome Browser
Species Human (GRCh38)
Location 13:40734355-40734377
Sequence ACAGTTGTGCCAGAAGACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107475768_1107475776 27 Left 1107475768 13:40734305-40734327 CCAACATAGAAGGGACAGAAGTC 0: 1
1: 1
2: 1
3: 9
4: 147
Right 1107475776 13:40734355-40734377 ACAGTTGTGCCAGAAGACCTAGG 0: 1
1: 0
2: 1
3: 14
4: 153
1107475773_1107475776 5 Left 1107475773 13:40734327-40734349 CCCAGGAGGAGGGCAAAATGATA 0: 2
1: 0
2: 2
3: 19
4: 202
Right 1107475776 13:40734355-40734377 ACAGTTGTGCCAGAAGACCTAGG 0: 1
1: 0
2: 1
3: 14
4: 153
1107475774_1107475776 4 Left 1107475774 13:40734328-40734350 CCAGGAGGAGGGCAAAATGATAG 0: 2
1: 0
2: 0
3: 14
4: 179
Right 1107475776 13:40734355-40734377 ACAGTTGTGCCAGAAGACCTAGG 0: 1
1: 0
2: 1
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107475776 Original CRISPR ACAGTTGTGCCAGAAGACCT AGG Intronic