ID: 1107477298

View in Genome Browser
Species Human (GRCh38)
Location 13:40750961-40750983
Sequence AAGTGGGTAAAGAGGTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107477298 Original CRISPR AAGTGGGTAAAGAGGTAAGC TGG (reversed) Intronic
901785690 1:11622986-11623008 AAGTTGGTGAAGGGCTAAGCTGG - Intergenic
901876922 1:12172143-12172165 AAGCGGGCAAGGAGGGAAGCTGG + Intronic
901991505 1:13118167-13118189 AAGTTGGTGTAGAGGTAAGAGGG - Intergenic
903790181 1:25887392-25887414 CAGTGGGTTAACAGGAAAGCCGG + Intronic
903868574 1:26415895-26415917 AAGTTGGTAGAGAGGTAGGAAGG + Intronic
906644734 1:47466229-47466251 CACTGGGTCAGGAGGTAAGCAGG - Intergenic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
910405394 1:86883789-86883811 AAGTGGGGCCTGAGGTAAGCAGG - Intronic
911721133 1:101192407-101192429 AAGTGGGTAATAGGGTAATCTGG + Intergenic
912424068 1:109570759-109570781 ATGAGGGTGAAGAGGTAGGCAGG + Intronic
914724267 1:150314326-150314348 AAATGGGTAGAGAGAAAAGCAGG - Intergenic
917680767 1:177364779-177364801 AGGTGGGTGAAGACCTAAGCAGG + Intergenic
917745502 1:178002946-178002968 AATTGGGTATAGGGGTAAGGAGG - Intergenic
918011429 1:180590555-180590577 AAGTGAATAGAGAGGTAGGCAGG + Intergenic
918406363 1:184215078-184215100 AAGAGAGTAAAGAGAAAAGCAGG + Intergenic
921340584 1:214129851-214129873 CAGTGGGTTAAGATGTAAGAAGG + Intergenic
923933214 1:238727083-238727105 TAGTGGGTCAAGAGGGGAGCTGG - Intergenic
924941530 1:248815628-248815650 AAGTAGGTAAAGGAGTTAGCTGG - Intronic
1063375506 10:5552031-5552053 TGGTGGCTAAAGAGGTAAACAGG + Intergenic
1064409293 10:15091477-15091499 ATGTGGTTGAAGAGGTCAGCAGG - Intergenic
1065438589 10:25726554-25726576 AAGTGGGGAGAGAGGAAAGAAGG - Intergenic
1065484375 10:26222697-26222719 CACTGGGTAAAGATATAAGCTGG - Intronic
1066596767 10:37059462-37059484 GAGGGGTTAAAGAGGTAAGCAGG + Intergenic
1067345781 10:45438297-45438319 CAGTAGGTAAAGAGCTCAGCCGG - Intronic
1067359037 10:45560038-45560060 AAGAGGCTAATTAGGTAAGCTGG + Intronic
1067938071 10:50627954-50627976 AAGAGTTTAAAGAGCTAAGCAGG - Intergenic
1068268162 10:54681439-54681461 ATGTGGCTAAAGAGATAAGAAGG + Intronic
1068400681 10:56523900-56523922 AATTGGGCAAAGAGTTAAGGTGG - Intergenic
1069190414 10:65480211-65480233 AAGGGGGAAAAGAGGGAAGTAGG + Intergenic
1071138316 10:82477927-82477949 AAGTGTGCAATGATGTAAGCAGG + Intronic
1072950614 10:99843887-99843909 AAGTGGAAAATGAGGTAAGGAGG + Exonic
1073218290 10:101849101-101849123 AAGTGGGTACAGAGGCCTGCAGG + Intronic
1075993828 10:126860381-126860403 AAGTGAGTAAAGGGGAAACCAGG - Intergenic
1076245422 10:128943700-128943722 AAGTGGGTAGAGAGGAGGGCTGG + Intergenic
1077350422 11:2090651-2090673 AAGTGCGCACAGAGGCAAGCGGG + Intergenic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1077458433 11:2695013-2695035 CAGTGGTCAGAGAGGTAAGCAGG + Intronic
1077587064 11:3461989-3462011 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1077870307 11:6257185-6257207 ATGTGGCTAGAGAGGTAAGTGGG + Intergenic
1078077377 11:8174206-8174228 AAATGGGCAAAGAGGTATTCAGG + Intergenic
1078938839 11:15977531-15977553 AACTGGGTAAAGAGGTAAGTGGG - Intronic
1079932854 11:26586726-26586748 AAGTGGATCAAGAGGTCAGGAGG - Intronic
1081770048 11:45644565-45644587 AACTGGGTAAAGAGGAGACCAGG + Intergenic
1082711454 11:56558648-56558670 AAGGGTGGAAAGAGGTTAGCTGG + Intergenic
1084829930 11:71760941-71760963 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085593428 11:77786933-77786955 AACTGGGTAAAGAGGCAAACAGG + Intronic
1085939234 11:81188337-81188359 AAGTGGGAAAAGAGGAAAAAAGG + Intergenic
1086052507 11:82610129-82610151 AAGGAGGGAAAGAGGGAAGCAGG + Intergenic
1087016205 11:93556699-93556721 AAGCTGGTAAAGAGACAAGCGGG + Intergenic
1087432843 11:98075419-98075441 TAGAGGGTAAAAAGCTAAGCAGG + Intergenic
1088558488 11:111087888-111087910 AAGTGGGTAAAGCTACAAGCTGG + Intergenic
1088634039 11:111802114-111802136 AAGTTGGTAAGGAGGGAAGTTGG - Intronic
1088831572 11:113540984-113541006 AAGAGGGTAAAGAGGCAGGTAGG + Intergenic
1089038885 11:115426699-115426721 GAGGGGGTAAAGGGGGAAGCAGG - Intronic
1091098026 11:132842169-132842191 AAGGGGGTAAAGTAGTAAACGGG - Intronic
1092413305 12:8270736-8270758 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1094768236 12:33622380-33622402 AAGTAGGTAATGAGGTAGGAGGG - Intergenic
1095947973 12:47764610-47764632 ATGTGGGTAACCAGGAAAGCAGG + Intronic
1098316500 12:69198813-69198835 AAATGGGTAAAGAGGAAGACAGG + Intergenic
1100022299 12:90084253-90084275 AAATGGGTTAAAAGGTAAACTGG - Intergenic
1105536246 13:21266938-21266960 GAGTGAGTAAAGAGGTAAGCTGG + Intergenic
1107477298 13:40750961-40750983 AAGTGGGTAAAGAGGTAAGCTGG - Intronic
1107590591 13:41899862-41899884 AAGTGGGTATTGATGTAAGGAGG - Intronic
1108620429 13:52177762-52177784 AAGTGTGTAAACAGGTAGGCTGG - Intergenic
1109642768 13:65211982-65212004 AATTGGGTGAAGAAGTAAGTAGG - Intergenic
1111104742 13:83630165-83630187 AATTGTGATAAGAGGTAAGCGGG + Intergenic
1111149770 13:84235150-84235172 AAGTGGGTAAAGCGGGACACTGG + Intergenic
1111579661 13:90206922-90206944 AAATGGTTAAAGAGGGAGGCTGG + Intergenic
1113398145 13:109968059-109968081 AAGGCAGTAAAGAGGTAAGTTGG + Intergenic
1116421482 14:44737682-44737704 GAGTGGGTCAAGAGAAAAGCTGG + Intergenic
1117061834 14:51971695-51971717 AGGTGAGTTAAGAGGTGAGCAGG - Intronic
1117099362 14:52331007-52331029 ATGTGTGTAAAGAGGTCAGAGGG - Intergenic
1117102820 14:52367906-52367928 AAGTGGGAAAAGAAGTAAATGGG + Intergenic
1119546287 14:75474253-75474275 AAGGGTGGAAAGAGGTTAGCTGG + Intergenic
1120151223 14:81036436-81036458 AAGTGCTTAAAGAGGTGAGGTGG + Intronic
1120154397 14:81076623-81076645 AAGTGGGTGATGAGGAAAGAAGG - Intronic
1120832390 14:89008869-89008891 GAGTGGATAAGGAGGTGAGCAGG + Intergenic
1122893477 14:104743773-104743795 AGGTGGGTATAGAGCTAATCCGG + Intronic
1124228858 15:27923209-27923231 AAGTGGATAAAGTGGTAGACTGG - Intronic
1124437495 15:29663060-29663082 TAGTGGGTACAGAGCTCAGCTGG - Intergenic
1126028444 15:44472657-44472679 AAGTGGGGAAAGAAATTAGCTGG - Intronic
1127464478 15:59231000-59231022 GAGGGGGTAAATAGGAAAGCTGG - Intronic
1127736919 15:61849844-61849866 AAGTGGGTGAAGAGAAAAACTGG + Intergenic
1129210136 15:74063662-74063684 GAGTGGGCAAAGAGGGAAGGAGG - Intergenic
1129403885 15:75301740-75301762 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129842075 15:78750106-78750128 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1130282961 15:82533291-82533313 GAGTGGGCAAAGAGGCAAGGAGG + Intergenic
1130803858 15:87297634-87297656 AAATGTGTAAAAAGGAAAGCAGG + Intergenic
1133354516 16:5126241-5126263 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1133430586 16:5733710-5733732 AAGGGAATAAAGAGGTAAGAGGG - Intergenic
1135110434 16:19686785-19686807 AAGTGGGAAAAGGGGTGAGAAGG - Intronic
1135274000 16:21095309-21095331 CAGTGGGTAAATGGTTAAGCTGG + Intronic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1136597601 16:31262294-31262316 AAGGAGGGAAAGAGGGAAGCAGG - Intronic
1136702273 16:32155130-32155152 AAGTGGGTAAAGGTGTGAGTGGG - Intergenic
1136765393 16:32772358-32772380 AAGTGGGTAAAGGTGTGAGTGGG + Intergenic
1136802706 16:33098026-33098048 AAGTGGGTAAAGGTGTGAGTGGG - Intergenic
1137612345 16:49827180-49827202 AAGTGGGTGATGAGGTCAGATGG - Intronic
1203067782 16_KI270728v1_random:1034585-1034607 AAGTGGGTAAAGGTGTGAGTGGG + Intergenic
1143120350 17:4602803-4602825 AAGTGGGTGAAGAGCAAAGGTGG + Intronic
1145112915 17:20180146-20180168 TAGTGAGCACAGAGGTAAGCAGG + Intronic
1147257892 17:39192896-39192918 AAGTGGGGAAAGAGGCATGAAGG + Intronic
1147497099 17:40927055-40927077 CAGTGAGCAAAGAGGTAAGGAGG - Intronic
1147962063 17:44173820-44173842 AAGTGGGAAGAGAGGTATGGGGG + Intronic
1153736142 18:8069836-8069858 AAGTGCGAGAAGAAGTAAGCTGG + Exonic
1153934481 18:9908955-9908977 AAGTGGCCAGAGAGGTAAGTAGG - Intergenic
1154166051 18:12015291-12015313 AAGTGGGTCAAGAGGGGAGGCGG - Intronic
1155424220 18:25689457-25689479 AAGGGGGAAGAGAGGAAAGCAGG + Intergenic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1156781373 18:40854475-40854497 AAGTAGGTACAGAGGCAAGGTGG - Intergenic
1157291944 18:46415898-46415920 AGGTGGGAGGAGAGGTAAGCAGG + Intronic
1157782120 18:50448910-50448932 ATGAGGCTAGAGAGGTAAGCAGG + Intergenic
1161635037 19:5382927-5382949 AGGTGGGGAAAGTGGGAAGCGGG - Intergenic
1161999676 19:7735382-7735404 AAGTATGCAAAGAGGTATGCAGG + Intergenic
1162884720 19:13688100-13688122 AAGTGGGTGAAGACTTAAACAGG - Intergenic
1162917515 19:13882284-13882306 AAGTGGGTAGAGAGGTTTGTGGG + Intergenic
1163389809 19:17023495-17023517 AAGAGGGTAAAGGGGGAAACTGG + Intronic
1165267226 19:34670092-34670114 AGTTGGATAAAGAGGTAATCGGG + Intronic
1166194312 19:41196084-41196106 ACGAGGGTAAAGAGGGAATCAGG + Intronic
925077335 2:1028203-1028225 TGTTGAGTAAAGAGGTAAGCAGG + Intronic
926667858 2:15544375-15544397 AAGGCGGGAAAGAGGGAAGCAGG + Intronic
926843262 2:17106024-17106046 GAGTGGATGGAGAGGTAAGCGGG + Intergenic
927346674 2:22052079-22052101 ATGTGGCTTAAGAGGTAAGCAGG - Intergenic
929687266 2:44045542-44045564 AGGAGGGTAAAGATGAAAGCAGG - Intergenic
930325615 2:49913659-49913681 AAGGGTGTAAAGAGGTAAGAGGG + Intergenic
930601948 2:53453816-53453838 AAATGGGTAAAGAGGTGATAAGG + Intergenic
931451681 2:62372593-62372615 AAGTGGGCAAAGAGATGAACAGG - Intergenic
932031633 2:68192826-68192848 AAATGGGGAAAGAGATAAGATGG - Intronic
934089424 2:88538363-88538385 AAGTGGAGAAAGGGGAAAGCAGG - Intergenic
935266999 2:101403238-101403260 AAGTGGGTAAGGAGGCCAGCTGG + Intronic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937842030 2:126533866-126533888 ATTTGGGTAAGGAGGTAAGGAGG + Intergenic
939010266 2:136838269-136838291 AATTGGGTATAGAGGGAAGGAGG + Intronic
939995410 2:148915089-148915111 AATGGGGTAAAGAGGTAAAGGGG + Intronic
940362995 2:152815738-152815760 AAGTGGTTAAAGAGGTGAAAAGG + Intergenic
940475532 2:154157494-154157516 AACTGATTAAAGAAGTAAGCAGG - Intronic
942617819 2:177812798-177812820 AAGCGGGTAAAGAGGGAAAAAGG + Intronic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
942707573 2:178793855-178793877 AAGAGGATAAGGAGGAAAGCTGG + Intronic
946138514 2:217667991-217668013 AAGTGGGAAAAGAGGAAGGTGGG + Intronic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
946953705 2:224905782-224905804 GAGTGGGCAGAGAGGAAAGCGGG - Intronic
949050011 2:241892584-241892606 AATTGGGTCATGAGGCAAGCAGG + Intergenic
1168949368 20:1786158-1786180 AGGTGGGTAAGGAAGGAAGCAGG + Intergenic
1169949147 20:11023706-11023728 AAGTGGGGAATGAGGTAATATGG - Intergenic
1170436289 20:16333087-16333109 ATGTGGGCAAAGAGGTAGGAAGG - Intronic
1173884329 20:46444059-46444081 AATTGGGAAAAAAGGCAAGCAGG - Intergenic
1175422480 20:58843235-58843257 CAGGGTGTAAAGAGGGAAGCTGG - Intronic
1175603595 20:60294977-60294999 AAGTGGGTGAAGTGGTCAGGTGG + Intergenic
1176953133 21:15068445-15068467 AAGTGGGAAAAGAGGTTCTCAGG + Intergenic
1177351673 21:19951278-19951300 ATGTGGGTGTAGAGGCAAGCAGG + Intergenic
1177724611 21:24950962-24950984 AGGTGGGGAAAGAGATAAGCTGG + Intergenic
1178444597 21:32627329-32627351 AAGTGGGTAAAGGGGTACACGGG + Intergenic
1183237425 22:36630121-36630143 ATGTGGCCACAGAGGTAAGCAGG + Intronic
1183476874 22:38040438-38040460 AAGTGGCTACAGAGGTCAGCAGG + Intronic
1185214310 22:49589799-49589821 GAGGGGGTAAAGAGGCAAGGAGG - Intronic
949333656 3:2950055-2950077 AGGTGGGTAAGCAGTTAAGCTGG - Intronic
949660667 3:6275047-6275069 AAATGGGGAAAGAAGGAAGCTGG + Intergenic
950204484 3:11068228-11068250 GAGTGGGTGCAGAGGTAAGGAGG - Intergenic
950965456 3:17142891-17142913 AAGGGGGTAAAGTGGCAAGAGGG - Intergenic
952566268 3:34662154-34662176 AAATGGATAAAGAGGAAAGGGGG + Intergenic
957058405 3:75461926-75461948 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
961295041 3:125877776-125877798 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
961903861 3:130242181-130242203 AGGTGAGTAAAGAGGGAAGAAGG - Intergenic
962202807 3:133414794-133414816 GAGTGAGTAGAGGGGTAAGCGGG - Intronic
967795931 3:193598660-193598682 AAGTGGGTGAATAGATAAGGAGG + Intronic
970174300 4:13323014-13323036 TTGTGGGGAAAAAGGTAAGCTGG - Intergenic
970495838 4:16625078-16625100 ATGGGGCAAAAGAGGTAAGCGGG - Intronic
972831326 4:42817012-42817034 AAGTGAATAAAGAGGGAGGCAGG + Intergenic
973195392 4:47433847-47433869 AAGTAGTTAACTAGGTAAGCCGG - Intergenic
973832483 4:54775577-54775599 CAGTGGGTAAAGTGGTGAACTGG - Intergenic
973877579 4:55235400-55235422 AAGTAGGTAAAGAAAGAAGCTGG + Intergenic
975825570 4:78316452-78316474 AGGTGAGTAAAGAGGTTGGCAGG - Intronic
975992223 4:80268563-80268585 AAGTGGGTAAGGCGGTAGGCTGG + Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
976636638 4:87293001-87293023 CAGTTGGAAAAGAGGCAAGCAGG + Intergenic
976771132 4:88653635-88653657 TAGTGGGTCAAGGGGGAAGCTGG + Intronic
977166042 4:93699009-93699031 AAGTAGGTAAAGTGCTAAGTAGG + Intronic
978910135 4:114052672-114052694 AAGTGGATAAGGAGGTAATAGGG - Intergenic
979772513 4:124546152-124546174 CAGTGGGTAAAGAAGCAAGAGGG + Intergenic
979796509 4:124853234-124853256 AAGTGGGTAAAACAGTAAGTTGG - Intergenic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
980869021 4:138589288-138589310 CAGTGGGGAAAGAGTTAGGCTGG - Intergenic
981993236 4:150949429-150949451 AAGTGGGTATAGCTGTAAGAGGG + Intronic
982060935 4:151603383-151603405 AAGGGGGAAAAGAGGAAACCCGG - Intronic
982652876 4:158108913-158108935 ATGTGGTTAAAGAGATCAGCAGG - Intergenic
986559389 5:9045614-9045636 AAGTGAGAAAAGTGGTACGCAGG - Intronic
987524819 5:19033687-19033709 AAGTTGTTAGAGAGGAAAGCAGG + Intergenic
987661451 5:20883580-20883602 AATTAGGTAAAGAGTTAAGAAGG + Intergenic
988762134 5:34321741-34321763 AATTAGGTAAAGAGTTAAGAAGG - Intergenic
988998630 5:36738521-36738543 ATGAGGCTGAAGAGGTAAGCAGG - Intergenic
990194099 5:53293726-53293748 AAGTGGGTAAAGATGTAGCTGGG - Intergenic
990217855 5:53553634-53553656 AAGTGGGTAAGGATGAATGCAGG + Intergenic
990743425 5:58935344-58935366 AAGTGGCTAGAGAGGTGAGGAGG - Intergenic
991174445 5:63670256-63670278 AAGTAGGTAAAGTGTTAAGAGGG + Intergenic
991334421 5:65530952-65530974 AAGTGGGAAAAGAAGAAAACAGG + Intronic
992624393 5:78624224-78624246 CGGTGGGTCAAGAGATAAGCTGG - Intronic
993007726 5:82446398-82446420 AAGTGGGTGATGAGGTAACCAGG + Intergenic
995155042 5:108901057-108901079 AGGTGGGCAAAGAGGTAAAGGGG - Intronic
995314542 5:110753176-110753198 AAGTGGGTTCAGAGGTGAGTGGG + Intronic
996385154 5:122902802-122902824 AGAAGGTTAAAGAGGTAAGCTGG - Intronic
996450777 5:123621668-123621690 AAGTGGGGAAAAAGGCAAGAAGG - Intergenic
997033574 5:130160330-130160352 TAGTGGGCAAGGAGGAAAGCAGG - Intronic
997605485 5:135172994-135173016 AAGGGGGAAAAGAGGGAGGCAGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1001155850 5:169271976-169271998 AAGTGGGTACAGAGGAGAGTAGG + Intronic
1001170038 5:169410584-169410606 ATGTGGGGACAGAGGTATGCAGG + Intergenic
1004109420 6:12700903-12700925 AAGAGGATAAAAAGGTAAGCAGG - Intergenic
1004585376 6:16994646-16994668 GAGTGGGTCAGGAGGTAAGCAGG + Intergenic
1009244135 6:61213978-61214000 AAATGGGTGAAGAGGAAAGAAGG + Intergenic
1009866721 6:69407023-69407045 AAGACAGTTAAGAGGTAAGCAGG + Intergenic
1011275944 6:85631407-85631429 GAGTGGGGAAAGAGGTAAGAAGG + Intronic
1011970065 6:93211447-93211469 AAGTGGGGAAAGGGGAAAGGGGG + Intergenic
1013273850 6:108565209-108565231 AAGTGATAAAAGAGGTAAGAAGG + Intronic
1013542916 6:111129251-111129273 AAGTGGGCAAAGAAGGAAGGGGG + Intronic
1015642903 6:135356068-135356090 AAATGGGTAAAGAAGTAAGCTGG + Intronic
1017193501 6:151677748-151677770 ATGTGGGCAAAGGGGTAAACAGG - Intronic
1017605788 6:156131416-156131438 AAGTGGGGACAGAGGAACGCAGG + Intergenic
1018381119 6:163259445-163259467 CAGTGGCTGAAGAGGTCAGCAGG - Intronic
1019521685 7:1463557-1463579 AAGTGGGGAAACAGGTCATCTGG - Intergenic
1020700663 7:11478404-11478426 AAGTGGGAAAAGAGGTGGCCTGG - Intronic
1021428092 7:20526168-20526190 AAGAGGGTTGAGAGGCAAGCTGG + Intergenic
1022711478 7:32854911-32854933 ATGAGGGTCAAGAGGTGAGCAGG + Intergenic
1022913177 7:34920048-34920070 ATGAGGGTCAAGAGGTGAGCAGG - Intergenic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG + Intergenic
1029160520 7:98548507-98548529 AAGTAGGTAGATAGGTAGGCAGG - Intergenic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1030742952 7:113131387-113131409 AAGGGGATTAAGAGGTGAGCAGG + Intergenic
1031646193 7:124229161-124229183 AAGAGGCGACAGAGGTAAGCTGG + Intergenic
1032704205 7:134408090-134408112 AAGTGGATAAGGAGGTAGGTAGG + Intergenic
1032720885 7:134550118-134550140 AGGTGAGTAAGGAGGTCAGCAGG - Intronic
1033086849 7:138350671-138350693 AAGTGGGCAAAAGGGCAAGCTGG - Intergenic
1033318120 7:140315444-140315466 AAGTGGCAAAAGAGGTAAAACGG + Intronic
1035463415 7:159060563-159060585 AAGTGAGTAAAGTGGTTAGGTGG - Intronic
1036374966 8:8192138-8192160 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
1036541461 8:9716663-9716685 AAGAGGGGAAAGAGGGAAGCAGG - Intronic
1036584079 8:10106889-10106911 AGGTGGGTAGAGGGGTAGGCGGG - Intronic
1036854577 8:12231013-12231035 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1036875936 8:12473506-12473528 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1038651349 8:29406705-29406727 AAGTGGGTGAACAGTTCAGCAGG + Intergenic
1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG + Intergenic
1040072667 8:43201169-43201191 AAGTGGGGAACGAGGGAAGGAGG - Exonic
1040716375 8:50257709-50257731 AAGTGGGAAGAGAGATAACCAGG + Intronic
1041608127 8:59809539-59809561 AAATGGGAAAAGAGGAAAGTAGG - Intergenic
1041713337 8:60912281-60912303 AAGTGGGGAGTGAGGAAAGCAGG + Intergenic
1047347074 8:124038920-124038942 GAGTGGGTAAAGAAGTAAAAAGG + Intronic
1047664534 8:127076194-127076216 GAGTCAGTAAAGAGGTGAGCTGG - Intergenic
1048437113 8:134428610-134428632 ATGGGGCTAGAGAGGTAAGCAGG + Intergenic
1048492388 8:134906199-134906221 CAGTGGGGAAAGAGGGATGCTGG - Intergenic
1048709441 8:137192128-137192150 AGGTGGGTAAAGCCATAAGCAGG - Intergenic
1051189865 9:14500052-14500074 ATGTGGCTAAAGAGGTAGGCAGG - Intergenic
1052364067 9:27591460-27591482 AAATGCATAAAGTGGTAAGCTGG + Intergenic
1052609388 9:30752273-30752295 AAGTGGGTATACAGTAAAGCTGG - Intergenic
1053191802 9:36077569-36077591 AAATGGGTAAAGAGGCAAGATGG + Intronic
1054870789 9:70045555-70045577 GAGTGGGGAAGGAGGTGAGCTGG - Intronic
1055172530 9:73276441-73276463 AGGTGGGGATAGAGTTAAGCTGG + Intergenic
1055882992 9:81024164-81024186 AACTGGGGAAAGAGAGAAGCTGG - Intergenic
1057745234 9:97745858-97745880 TAGTGGGTGAAGAGGAAAGAGGG - Intergenic
1058006300 9:99918954-99918976 AAGTAGGTGAAGAGGTGAACAGG + Intronic
1058779975 9:108323759-108323781 AAGGATGTAAAGAAGTAAGCAGG + Intergenic
1059966226 9:119616955-119616977 AAGTGGCTAATGAGGTGAGGAGG + Intergenic
1060328217 9:122639009-122639031 AAGTGAGTAAGCAGGCAAGCAGG - Intergenic
1060456662 9:123804951-123804973 AAGTGAGTGCAGAGGTATGCTGG - Intronic
1061193129 9:129093832-129093854 AAGCGGGTAAAGAGGGAGGCTGG - Intergenic
1061459489 9:130725235-130725257 AAGTGGGGAAAGAGGGAAATGGG - Intronic
1185933557 X:4230277-4230299 AAGTAGGTAAATAGGTAGGTGGG - Intergenic
1187090075 X:16087134-16087156 AAATGGGTAAAGAGGTTACATGG + Intergenic
1187267228 X:17746752-17746774 AAGTGGGTGCAGAGGCGAGCTGG + Intronic
1187317233 X:18207120-18207142 AAGTGGGTGCAGAGGCGAGCTGG - Intronic
1187764865 X:22630363-22630385 AGGTGGGTGAAGAGGCAGGCGGG + Intergenic
1188772021 X:34163740-34163762 AAGTTGGTAGAGAGGTAATGAGG + Intergenic
1189616294 X:42788148-42788170 AATTGTGTAAAGAGGTATGTTGG - Intergenic
1190428396 X:50354164-50354186 GAGTGGCTACAGAGGTAAGTAGG + Intergenic
1192238372 X:69310695-69310717 AAGTGGGTAGAGAGGTACCAGGG + Intergenic
1194889502 X:99361049-99361071 TAGTGGATAAAGATCTAAGCAGG + Intergenic
1195825383 X:108994472-108994494 CAGTGGGTAAACAGACAAGCAGG - Intergenic
1195956280 X:110334156-110334178 AAAAGGAAAAAGAGGTAAGCTGG - Intronic
1196815516 X:119662596-119662618 ATGAGGCTGAAGAGGTAAGCAGG - Intronic
1197517414 X:127450903-127450925 AAGTGGGTCAAAGGGCAAGCTGG + Intergenic
1198766411 X:140084398-140084420 AAGTGGGTATAGATATAAGAAGG + Intergenic
1198767061 X:140091206-140091228 AAGGGGGCTAAGAGGTAGGCAGG + Intergenic
1199494330 X:148436467-148436489 CAGTGGGTGAAGGAGTAAGCCGG - Intergenic
1199939936 X:152615220-152615242 ATGAGGGTAAAGAGGCAGGCAGG + Intergenic
1201954114 Y:19602298-19602320 AAATGGCTGAAGAGGTAAGAAGG + Intergenic