ID: 1107479173

View in Genome Browser
Species Human (GRCh38)
Location 13:40771235-40771257
Sequence CTCCCCCTTTGCGCTCCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107479159_1107479173 13 Left 1107479159 13:40771199-40771221 CCCCGCCCTCTCTTCCGCTTCCG 0: 1
1: 0
2: 2
3: 17
4: 292
Right 1107479173 13:40771235-40771257 CTCCCCCTTTGCGCTCCGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1107479163_1107479173 8 Left 1107479163 13:40771204-40771226 CCCTCTCTTCCGCTTCCGGCCTG 0: 1
1: 0
2: 0
3: 18
4: 251
Right 1107479173 13:40771235-40771257 CTCCCCCTTTGCGCTCCGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1107479158_1107479173 23 Left 1107479158 13:40771189-40771211 CCAAACACGTCCCCGCCCTCTCT 0: 1
1: 0
2: 0
3: 9
4: 193
Right 1107479173 13:40771235-40771257 CTCCCCCTTTGCGCTCCGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1107479166_1107479173 -1 Left 1107479166 13:40771213-40771235 CCGCTTCCGGCCTGGCGCCTTCC 0: 1
1: 0
2: 1
3: 15
4: 232
Right 1107479173 13:40771235-40771257 CTCCCCCTTTGCGCTCCGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1107479162_1107479173 11 Left 1107479162 13:40771201-40771223 CCGCCCTCTCTTCCGCTTCCGGC 0: 1
1: 0
2: 5
3: 28
4: 435
Right 1107479173 13:40771235-40771257 CTCCCCCTTTGCGCTCCGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1107479157_1107479173 29 Left 1107479157 13:40771183-40771205 CCGCTGCCAAACACGTCCCCGCC 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1107479173 13:40771235-40771257 CTCCCCCTTTGCGCTCCGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1107479160_1107479173 12 Left 1107479160 13:40771200-40771222 CCCGCCCTCTCTTCCGCTTCCGG 0: 1
1: 0
2: 4
3: 23
4: 297
Right 1107479173 13:40771235-40771257 CTCCCCCTTTGCGCTCCGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1107479156_1107479173 30 Left 1107479156 13:40771182-40771204 CCCGCTGCCAAACACGTCCCCGC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 1107479173 13:40771235-40771257 CTCCCCCTTTGCGCTCCGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1107479164_1107479173 7 Left 1107479164 13:40771205-40771227 CCTCTCTTCCGCTTCCGGCCTGG 0: 1
1: 0
2: 2
3: 16
4: 153
Right 1107479173 13:40771235-40771257 CTCCCCCTTTGCGCTCCGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1107479167_1107479173 -7 Left 1107479167 13:40771219-40771241 CCGGCCTGGCGCCTTCCTCCCCC 0: 1
1: 0
2: 2
3: 78
4: 722
Right 1107479173 13:40771235-40771257 CTCCCCCTTTGCGCTCCGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107479173 Original CRISPR CTCCCCCTTTGCGCTCCGGT GGG Intergenic
900463717 1:2813554-2813576 CTCCCACTGTGGGCTCCCGTGGG + Intergenic
905248531 1:36631113-36631135 CTCTCCCTTTGCCCTGAGGTTGG - Intergenic
912478276 1:109957051-109957073 CTCCTCCTTTGGTCTCAGGTAGG - Intergenic
914772149 1:150697237-150697259 CTCCCCCTGTGAGCTCCGATTGG - Intergenic
916454302 1:164954671-164954693 CTTCTCCTTTACTCTCCGGTGGG + Intergenic
921130429 1:212215117-212215139 CTCCCCCTTTGCTGTCTGGATGG + Intergenic
1063414595 10:5863177-5863199 CTCCCCCTTCCCTCTCCTGTGGG - Intronic
1065003891 10:21362075-21362097 CTCCCCCTTTCCCCTCCTTTGGG - Intergenic
1071456823 10:85857447-85857469 CTCCCCCATTGGGCTCCCGCTGG - Intronic
1079388038 11:19998178-19998200 CTCCCCCTTTTCCTTCCAGTCGG + Intronic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1083897683 11:65628388-65628410 CGCCCCCTTTGAGCTCAGGCAGG + Intronic
1085835366 11:79950336-79950358 CTCACCCTTTGCTTTCCTGTTGG - Intergenic
1090455301 11:126843882-126843904 CTCCCCTTTTGAGCCCAGGTAGG - Intronic
1095703646 12:45216130-45216152 CTCCGGCTCTGGGCTCCGGTCGG + Exonic
1096618632 12:52848686-52848708 CTCTCCCTGTGCCCTCCGGGGGG - Exonic
1103823786 12:123719801-123719823 CTCCCCCTGTGTGGTCCGGATGG - Intronic
1103855965 12:123972128-123972150 CTCCCCCTTGGCACTGGGGTGGG + Intronic
1107479173 13:40771235-40771257 CTCCCCCTTTGCGCTCCGGTGGG + Intergenic
1108622063 13:52194477-52194499 CCCTCCCTTTGCTTTCCGGTGGG + Intergenic
1108664638 13:52617438-52617460 CTCTCCCTTTGCTTTCCGGTGGG - Intergenic
1115443438 14:33462368-33462390 CTGCCCCTTTGAGGTCGGGTGGG + Intronic
1120850110 14:89162444-89162466 CTGCCCCTTTGCCGTCCGATTGG + Exonic
1121269419 14:92627996-92628018 CTCCCCCTGTGGGCTGGGGTCGG + Intronic
1121919279 14:97865722-97865744 CTCCCCCTTTGCTCTGGGGGTGG - Intergenic
1125087078 15:35742700-35742722 CTCGCCCTCTGCCCTCCAGTAGG + Intergenic
1132549803 16:549674-549696 CTCCTACTTTGCGCTCCAGGCGG + Exonic
1133363003 16:5188755-5188777 CACCCCCTTTGAGCTCAGGTGGG + Intergenic
1141869472 16:86775027-86775049 CTCCACATTTGCCCTACGGTGGG + Intergenic
1146655960 17:34635319-34635341 CTCCCCCTCTGCTCTCAGGGAGG - Intronic
1149293359 17:55238412-55238434 CTTCCCATCTGCGCTCCGGCCGG - Intergenic
1150634006 17:66899847-66899869 CTCCCTCTTTTCCCTCCTGTGGG + Intergenic
1152525474 17:80885935-80885957 CGCCCCTTTTGCGCTGGGGTGGG - Intronic
1153442181 18:5132778-5132800 CTGGCCCTTTGGGCTCTGGTCGG + Intergenic
1156480347 18:37432336-37432358 CTCCCCCTCTGGGCCCAGGTGGG - Intronic
1164595598 19:29529151-29529173 CTCCTCCCCTGCGCCCCGGTGGG - Intronic
1165496133 19:36152665-36152687 GTACCGCTTTGGGCTCCGGTGGG - Exonic
926384836 2:12325787-12325809 CTCACCCTTTTCTCTCCTGTGGG - Intergenic
929858177 2:45652667-45652689 CTCCCTCTGTGCCCTCCAGTTGG + Intronic
931622652 2:64226796-64226818 CTCCCCCTTTGCCTTCCACTAGG + Intergenic
939315497 2:140544471-140544493 CTCACCCTCTGCCCTCCAGTGGG + Intronic
1169093115 20:2873369-2873391 CCCCGCCCTTGCGCTCCGCTGGG - Intronic
1170986721 20:21265891-21265913 CTCCCCATTTGCTCGCCTGTAGG - Intergenic
1179788071 21:43741000-43741022 CTCCCCCATTGCTGTCCGGAAGG - Intronic
1183562442 22:38586184-38586206 CTCCTCCTTTCCCCTCCTGTGGG + Exonic
1185071894 22:48661228-48661250 GTCCCTCTCTGCGCTCTGGTGGG - Intronic
952771392 3:37004762-37004784 CTGCCCCTTTGCCCTTCAGTTGG + Intronic
954907616 3:54076312-54076334 CTCCCCCTGTGGGCTGGGGTAGG - Intergenic
960634621 3:119770916-119770938 CTCCCCATTAGCACTCTGGTTGG - Intergenic
965716853 3:171614030-171614052 CTCACCATTTGAGCTCTGGTAGG - Intronic
969497209 4:7533063-7533085 CTCCCTCTTTGGGCTGCTGTGGG - Intronic
975224677 4:71858041-71858063 CTCCCCCTGTGCGATCAGGTTGG - Intergenic
975551438 4:75616947-75616969 CCCACCCTTTGCCCTCCGGTAGG - Intronic
987340605 5:16936143-16936165 CCCTCCCTCTGCGCTCCGGCCGG + Exonic
988994671 5:36703470-36703492 CTCCCTCAGTGCGCTCCAGTTGG + Intergenic
1003074553 6:2971645-2971667 CTCTCCCTTCGCGCTCCGGACGG - Intronic
1006783615 6:36649898-36649920 CTGCCCCTTTGCCCTCAGGCAGG - Intergenic
1015322808 6:131894882-131894904 CTCCTTCTTTGCGCTATGGTAGG + Exonic
1017385758 6:153880805-153880827 CTCCTCCTTTCCTCTCCTGTAGG - Intergenic
1019419673 7:945253-945275 CCGCCCCTTTTCGCTCCGATGGG - Intronic
1019662497 7:2232634-2232656 CTCCCCCTTTGGGCTGTGCTGGG - Intronic
1019681774 7:2354557-2354579 CTCCCCCTTTCCTTTCCCGTCGG - Intronic
1020224776 7:6272065-6272087 CGCCCCCTTTCAGCTCAGGTGGG - Intronic
1022439715 7:30423755-30423777 CTCCCCCTTTGGCCTTCAGTGGG + Intergenic
1022913796 7:34926383-34926405 CTCCCCCTTTGCCCTGCCATTGG + Intergenic
1033407133 7:141080706-141080728 CTTCCCCTTTGCGCTTCGTAAGG - Intronic
1037752637 8:21692732-21692754 CTCCCTCTCTGCCCTCGGGTGGG - Exonic
1037805880 8:22057698-22057720 CTCCCCCTGTGCCCGCCGCTGGG + Intronic
1040498711 8:47989251-47989273 CTCCCCCTGTGCGGTCTGGATGG + Intergenic
1040692559 8:49957691-49957713 CTTCCCCTTTGCCCTTTGGTTGG + Intronic
1041449922 8:57995063-57995085 CGCCCCCTCTGCGCTCGGCTTGG + Intronic
1042226638 8:66519755-66519777 ATCCCCCTTTGGGCTCCTCTGGG - Intergenic
1049298984 8:141859786-141859808 CTCTCCCTTTGCCCTCCGTCCGG + Intergenic
1049740536 8:144238952-144238974 CTCCACCTTGGAGCTCCGGCAGG + Intronic
1053577969 9:39371976-39371998 CTTCCCCTTTGCTGTCCGGATGG + Intergenic
1053842496 9:42200035-42200057 CTTCCCCTTTGCTGTCCGGATGG + Intergenic
1054099553 9:60930761-60930783 CTTCCCCTTTGCTGTCCGGATGG + Intergenic
1054120950 9:61206385-61206407 CTTCCCCTTTGCTGTCCGGATGG + Intergenic
1056942359 9:90966465-90966487 CTCACCCTTTGGGCTCTGGAGGG + Intergenic
1061478352 9:130884168-130884190 CGGCCCCTCTGCGCTCCGGCTGG - Exonic
1192146186 X:68684488-68684510 TTTCCCTTTTGCTCTCCGGTTGG - Intronic
1192776391 X:74250121-74250143 CTCCCTCTGTGCGGTCCGGATGG - Intergenic
1195200557 X:102546763-102546785 CTGCCCCTTTGCCGTCCGATTGG + Intergenic
1195370892 X:104171104-104171126 CACCCCCTTTTCTCTCAGGTGGG - Intronic
1198623544 X:138541695-138541717 CTCCTCCTTTGTGCTCCAGGAGG + Intergenic