ID: 1107481027

View in Genome Browser
Species Human (GRCh38)
Location 13:40786458-40786480
Sequence ATGGAGAGGAGAAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 835
Summary {0: 1, 1: 1, 2: 6, 3: 84, 4: 743}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107481020_1107481027 9 Left 1107481020 13:40786426-40786448 CCGATAGTTTCTTATAGAACAAA 0: 1
1: 0
2: 3
3: 41
4: 333
Right 1107481027 13:40786458-40786480 ATGGAGAGGAGAAATGTGGAAGG 0: 1
1: 1
2: 6
3: 84
4: 743

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107481027 Original CRISPR ATGGAGAGGAGAAATGTGGA AGG Intergenic
900031158 1:373981-374003 ATGGAGAGGAGAAAGGAGACGGG - Intergenic
900031192 1:374102-374124 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
900051725 1:602230-602252 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
900051746 1:602302-602324 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
900288528 1:1914010-1914032 ATGGAGAGGAGAGAGGTTGATGG + Intergenic
901157807 1:7152298-7152320 AAGGAGAACAGAAACGTGGAAGG - Intronic
901773474 1:11543198-11543220 GTGGAGAGGAGGCCTGTGGAAGG - Intergenic
902084416 1:13848070-13848092 ATGGAGAGGAGAAACTTGTTGGG + Intergenic
902231266 1:15029193-15029215 ATGGTGAGGAGGAGGGTGGATGG + Intronic
902939288 1:19788245-19788267 ATGGAGAGGAGAAAAATGACTGG + Intronic
903546896 1:24130153-24130175 GGAGAGAGGAGAAATGTCGATGG + Intronic
903796604 1:25933656-25933678 AAGGAGAGGAGATATGTGGGAGG + Intergenic
903850939 1:26305769-26305791 AAGGAGAGAAAAAATGTGGTTGG - Intronic
903964326 1:27077028-27077050 AGGGAGGGGAGAAAAGAGGAGGG - Intergenic
903974344 1:27139307-27139329 AGGAAGGGGAGAAATGTGGCTGG - Intronic
904336024 1:29798644-29798666 TTGGGGAAGAGATATGTGGATGG + Intergenic
904577730 1:31516079-31516101 AAGGAAAGGAGAAAGGAGGAAGG - Intergenic
904851462 1:33462781-33462803 AGGGAGGGGAGACAGGTGGATGG + Intergenic
905585228 1:39111960-39111982 ATGGAGAAGAGAGATGTGTTAGG - Intronic
905919517 1:41710163-41710185 GTGCAGATGAGAAATGTGGCAGG - Intronic
905970282 1:42136710-42136732 AAGGAGGGGAGAAAAGAGGAAGG - Intergenic
906263460 1:44410178-44410200 CTGGAGAAAAGAAATGTGAAGGG - Intronic
906373046 1:45270570-45270592 ATGAAGACGTGAAATTTGGAGGG + Intronic
906562023 1:46765314-46765336 ATGGAGAGAAGGAATGAAGAGGG - Intronic
906680274 1:47721531-47721553 GTGGAGATGGGAAATGTGGATGG - Intergenic
906744683 1:48213520-48213542 AGGGAGAGTAGAGATATGGAGGG + Intergenic
906800373 1:48731955-48731977 ATGGAGGGGAGAAATGAGTGTGG + Intronic
907219576 1:52896420-52896442 CTGGAGAGGTGAAATGATGAAGG + Exonic
907964412 1:59315386-59315408 AAGGAGAGGAGAAAAGAGAAGGG - Intronic
908477873 1:64506506-64506528 ATGCAGAGGAGGATTATGGAGGG + Intronic
910005516 1:82391349-82391371 ATGGGGTAGAGAAGTGTGGAGGG + Intergenic
910087064 1:83416038-83416060 ATGCAGATGAGAGATGAGGAAGG + Intergenic
910089571 1:83446160-83446182 TTGCAGAGGAGAAATGAGAATGG + Intergenic
910279456 1:85482691-85482713 ATGGAGGGATGAAATGTGGATGG + Intronic
910354824 1:86342178-86342200 GTGGGGAGCAGAAAAGTGGAGGG - Intergenic
910948303 1:92617366-92617388 TTGGAGAAGAGGTATGTGGATGG + Intronic
911415785 1:97571537-97571559 TTGAAAAGGAGAAAAGTGGAGGG + Intronic
912642488 1:111360768-111360790 ATGCAGAGGGGAGATGGGGAAGG - Intergenic
912661052 1:111530921-111530943 AAGGAGAGGAGAAATAGGGATGG - Intronic
913319450 1:117578120-117578142 ATGGAGAGGAAAGTTGTTGAGGG - Intergenic
914259647 1:145988199-145988221 CTGGGAAGGAAAAATGTGGAGGG - Intergenic
914677921 1:149917931-149917953 GGGGAGAGGAGAAAAGAGGATGG + Intergenic
914855206 1:151345679-151345701 ATGGAGAGGAGGGAAGTAGAGGG + Intronic
914915468 1:151816545-151816567 ATGGAGAGGAGACCAGAGGATGG + Intronic
914963161 1:152224855-152224877 ATGGAGGGGAGAAATGGAGCTGG - Intergenic
915885908 1:159720690-159720712 ATGCAGAGGAGAGATGTAAAAGG + Intergenic
915910791 1:159914030-159914052 ATGGAAAGGAGAGTTGGGGAAGG - Intergenic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
916060454 1:161094901-161094923 ATGGAGAGGTGGAATAAGGATGG - Intergenic
916291144 1:163167568-163167590 ATTGACAGGAGGAATGTGTAGGG + Intronic
917717666 1:177754391-177754413 GTGGAGAGGAGAAATGAAGAAGG + Intergenic
917962511 1:180155652-180155674 AGGGAGTGGAGAAAGGTGGCAGG - Intronic
918874414 1:190021023-190021045 ATGGAGATGAGCATTTTGGATGG - Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919161803 1:193840171-193840193 AGAGAGAGGAGAGATGGGGAAGG + Intergenic
919241860 1:194924860-194924882 TTGGAGAAGAGGTATGTGGATGG + Intergenic
919318061 1:195999986-196000008 TTGGGGAAGAGATATGTGGATGG + Intergenic
919322787 1:196064508-196064530 ATGTATAGGAGAAAGCTGGAGGG - Intergenic
919688417 1:200506494-200506516 GAGGTGAGGAGAGATGTGGAAGG + Intergenic
919750934 1:201037775-201037797 CTAGAGAGGAGAAATGAGAATGG + Intergenic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920311550 1:205051760-205051782 GTGGAGTGGTCAAATGTGGAGGG + Intronic
920713510 1:208317650-208317672 ATTGGAAGGACAAATGTGGATGG + Intergenic
920937824 1:210452198-210452220 ATGGAGAGGCGAATTATGGGAGG - Intronic
921131838 1:212226396-212226418 ATGGAGAGAGGAAGTGGGGAAGG - Intergenic
921747772 1:218756932-218756954 ATGGGGATGTGAAATGAGGATGG + Intergenic
922597420 1:226824582-226824604 CAGGAGATGAGGAATGTGGATGG - Intergenic
923227371 1:231950822-231950844 AAGGAAAGGAGAAATGAGTAAGG - Intronic
923694109 1:236229671-236229693 ATGGAAAGGTGAAATGTTGTAGG - Intronic
923897489 1:238288299-238288321 ATGAAGAGGAGATAAGAGGATGG - Intergenic
923909148 1:238420200-238420222 ATGGAGACCAAAAATATGGATGG - Intergenic
924268721 1:242309716-242309738 ATGGACAGGAGAGAATTGGAAGG - Intronic
924454053 1:244203876-244203898 AGGGAAAGAAGAAATGAGGAAGG - Intergenic
1062812490 10:477341-477363 AGGGAGGGGAGGAAGGTGGATGG + Intronic
1063075869 10:2716037-2716059 ATTAAGAGTAGAAATGTGGCCGG + Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063563716 10:7152898-7152920 ATGCAGATGAGAAATCTGAATGG - Intergenic
1063657314 10:8004696-8004718 ATAGAGAGGAAAAATCTGAAAGG - Intronic
1063953947 10:11248417-11248439 ATGGAGAGGAGGAGGGTGGAAGG - Intronic
1064117150 10:12588092-12588114 AGGGAGCGGAGAAACTTGGATGG + Intronic
1064577893 10:16764343-16764365 ATGGAGAGGAAGAGAGTGGAAGG - Intronic
1064818187 10:19291432-19291454 ATTGAGAGGGGAAAGGTGGTTGG + Intronic
1065384235 10:25117709-25117731 CAGGAAAGGGGAAATGTGGAGGG + Intergenic
1065695045 10:28371972-28371994 AGAGAGAGGAGAAATGAGGAGGG + Intergenic
1065744137 10:28823336-28823358 ATGGAGAAGAGAAAAATAGAAGG - Intergenic
1065935390 10:30516246-30516268 CTGGAGGGGAGACATGTGGCTGG + Intergenic
1066277659 10:33884722-33884744 ATGGAGAAGAGAGAAGTGGATGG - Intergenic
1066447319 10:35495471-35495493 ATGGAGAGGAGAAAATTCCAGGG - Intronic
1066471234 10:35700317-35700339 AGGGAGAGGACAAAACTGGAAGG + Intergenic
1066716185 10:38289049-38289071 ATGGACAGGAGAGAATTGGAAGG + Intergenic
1066778435 10:38912450-38912472 ATGGAGAGGAGTGGAGTGGAGGG + Intergenic
1067012310 10:42726002-42726024 ATGGAGAGGAAGAGAGTGGAAGG + Intergenic
1068298548 10:55107956-55107978 TTGGAGATGAGACATTTGGAAGG + Intronic
1068905616 10:62318293-62318315 ATGGGGAGGAGAGAGTTGGAGGG - Intergenic
1069125624 10:64628933-64628955 AAGGAGAGCTGAAAAGTGGATGG - Intergenic
1069802953 10:71093611-71093633 AGGAAGAGGAGAAATGTAAAAGG + Intergenic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1071194205 10:83138579-83138601 ATGGAGAGGAGAACTGGGCTGGG - Intergenic
1071199572 10:83204064-83204086 TTGGAGAGGAGAAATGTATGTGG - Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1072164754 10:92802402-92802424 ATGGTGAGCAGAAAGTTGGAAGG + Intergenic
1072413047 10:95222686-95222708 GTGGAGAGGAGAAAACAGGAAGG + Intronic
1072839982 10:98762009-98762031 AAGGAGAGGAGAAGAGGGGAGGG - Intronic
1072974308 10:100044304-100044326 AAGGAGTGGTGACATGTGGAAGG + Intronic
1073065152 10:100754113-100754135 CTGGAGAGGGGAGAGGTGGAGGG + Intronic
1073077708 10:100835113-100835135 TTGGAGAAGGGAGATGTGGATGG - Intergenic
1073233997 10:101997616-101997638 ATGGAGAGGAGAGAAGTGATTGG + Intronic
1073339619 10:102735135-102735157 AGGGAGAGGAGCAACTTGGAGGG - Intronic
1073339709 10:102735504-102735526 AGGGAGAGGAGAAACTTGGAGGG - Intronic
1073918387 10:108431672-108431694 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1076077005 10:127541795-127541817 ATGGAGGGTAGAAATGGGAACGG - Intergenic
1076119954 10:127927616-127927638 ATGGAGAGGAGCCTTCTGGAGGG + Intronic
1076488048 10:130836790-130836812 ATGCATAGGAGAACTGTGGCTGG - Intergenic
1078261573 11:9714640-9714662 AGGCAGAGGAGAATTCTGGATGG + Intronic
1078456216 11:11477502-11477524 AGGGAGAGGAAAGGTGTGGAGGG - Intronic
1078595819 11:12685798-12685820 ATGAAGAGGAGACACCTGGAAGG + Intronic
1078845939 11:15118382-15118404 TTGGAAAGGAGAAAGCTGGAGGG + Intronic
1079085252 11:17440456-17440478 ATAGACAGGGGAAATTTGGAAGG - Intronic
1079743660 11:24097763-24097785 AAGGAGAGAGGAAAGGTGGAAGG - Intergenic
1080005517 11:27402130-27402152 ATGGAGCTGAGTCATGTGGACGG - Intronic
1080517150 11:33034934-33034956 ACAGAGAGGGGAAAGGTGGAAGG - Intergenic
1081059177 11:38451315-38451337 ATGGTGGGGATAGATGTGGATGG + Intergenic
1081237200 11:40659681-40659703 ATGGAGAGGAGAGCTGTAGTGGG - Intronic
1081734806 11:45395222-45395244 AGGAAGAGGAGAAAGGTGGAAGG - Intergenic
1082671779 11:56043675-56043697 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1083996574 11:66276015-66276037 AGGGAGAGGAGAGAAGAGGAGGG - Intronic
1084157821 11:67324424-67324446 ATGGAGAGATGAATGGTGGAAGG - Intronic
1084934700 11:72580705-72580727 GAGGAGGGGAGAAAGGTGGAAGG - Intronic
1085806301 11:79639909-79639931 ATGGAGGGGAGAAATGTTCATGG - Intergenic
1085887364 11:80536251-80536273 ATGTAGAGGAGAAGTGTGGCAGG - Intergenic
1086276882 11:85140707-85140729 ATGGAGGGGAAAAGTGGGGATGG - Intronic
1086493414 11:87378054-87378076 ATGGAGAGGAGAGCTGGAGAGGG + Intergenic
1086509773 11:87543847-87543869 ATGGAGATGAGAAACTTGGTGGG - Intergenic
1086906356 11:92422531-92422553 TTGAAGAGGAGAACTGTGGCAGG + Intronic
1087043061 11:93820401-93820423 ATGGAGTTGAGGACTGTGGATGG - Exonic
1087717499 11:101625421-101625443 AGGGAGAGGTGAAAAGAGGAAGG - Intronic
1088033380 11:105279786-105279808 AAAGAGAGGAGATATTTGGAGGG + Intergenic
1089554028 11:119305005-119305027 AGGGAGAGCAGAGATGTGGCAGG + Exonic
1089845184 11:121452640-121452662 AGGGAGAGGAAAAAACTGGAGGG - Intronic
1090119112 11:124005762-124005784 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1090475690 11:127018109-127018131 AGGGAAGAGAGAAATGTGGAAGG + Intergenic
1090510632 11:127371065-127371087 ATGGAGAAGAGAGATGAGAAAGG - Intergenic
1090603896 11:128401501-128401523 ATGGAAAGGACAAGTGTGCAAGG - Intergenic
1091348878 11:134876870-134876892 GTGGAGAGGGGGCATGTGGAGGG - Intergenic
1092229769 12:6769967-6769989 ATGGAGAGGAGGAAGATGAAGGG + Exonic
1092282229 12:7106919-7106941 ATGAGGAGGGGAAATGTGGGTGG + Intronic
1092484506 12:8890868-8890890 ACTGAGAGAAGAAATGTGGAAGG - Intergenic
1092966195 12:13645780-13645802 TTGGACAGGAGAAATGCTGAAGG - Intronic
1095603940 12:44044967-44044989 TTGGGGAAGAGATATGTGGATGG + Intronic
1095732273 12:45519053-45519075 ATGAGGAAGAGCAATGTGGAAGG - Intergenic
1096288854 12:50323882-50323904 TTGGGGAAGAGATATGTGGATGG + Intergenic
1096591595 12:52663644-52663666 ATACAGAGTAGGAATGTGGAGGG + Intergenic
1096870560 12:54589687-54589709 GTGGAGAGAAGAACTGGGGATGG + Intergenic
1097391540 12:59021178-59021200 TAGGGGTGGAGAAATGTGGATGG - Intergenic
1098432601 12:70436022-70436044 ATGGAGAAGAGAAAAGTAAAGGG + Intergenic
1098709179 12:73733167-73733189 GAGGAGGGGAGAAATGGGGATGG + Intergenic
1098709414 12:73736752-73736774 TTGGAGGGGAGAAAACTGGATGG - Intergenic
1098831817 12:75373397-75373419 TTGGAGAAGAGGTATGTGGATGG - Intronic
1098862275 12:75723519-75723541 ATGGAGGGTAGAAGTGAGGAAGG - Intergenic
1099304668 12:80938111-80938133 ATGGAAAGGGGATATGGGGAAGG + Intronic
1099578151 12:84406024-84406046 ATGGTGAAGAGATATGTGGATGG + Intergenic
1100136791 12:91562879-91562901 AAGGAGGGGAAAAATGTGTATGG - Intergenic
1100223277 12:92530296-92530318 ATGGACAGGGGAAATGGGGTTGG - Intergenic
1100672553 12:96832709-96832731 AAGGAGAGGACAAATGTTAAAGG + Intronic
1100715472 12:97301159-97301181 ATGGACAATAAAAATGTGGAAGG - Intergenic
1101058397 12:100944531-100944553 GAGGAAAGGAGAAATATGGAAGG - Intronic
1101278895 12:103229642-103229664 ATGGAAAATAAAAATGTGGAAGG - Intergenic
1101283668 12:103286626-103286648 ATAGAGAGGAAAAATGTGTGTGG + Intronic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101309415 12:103562806-103562828 ATAGAGAGGTGAGGTGTGGAAGG - Intergenic
1101868306 12:108540669-108540691 TTGAAGAGGAAAAAGGTGGATGG + Intronic
1101909407 12:108850493-108850515 ATGGGGAGGAGAAATGGGAGAGG + Intronic
1102030687 12:109738485-109738507 ATGGAGGTGAGAACTGTGGGAGG + Intronic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1103004350 12:117409356-117409378 ATGGAGGGGTGGAAGGTGGATGG + Intronic
1103151859 12:118647787-118647809 AAGGAGAAAAGAAATATGGAAGG + Intergenic
1103425977 12:120834323-120834345 ATGGAGTGGTGAAATGTGATCGG + Intronic
1104390325 12:128386426-128386448 ACGGAAAGGGAAAATGTGGAGGG - Intronic
1104435316 12:128751436-128751458 TGGGAGAGGGGAAATGGGGAAGG + Intergenic
1104559651 12:129832257-129832279 AAGGAGAGGAAAAAGGGGGAGGG + Intronic
1104676012 12:130713040-130713062 AGGGAGAGGAGGAATGAGGGAGG + Intronic
1104783777 12:131437147-131437169 AAGGAGAGGAAACAGGTGGAGGG - Intergenic
1105059432 12:133134980-133135002 ATGGAGAAAGGAAATGTGGCTGG - Intronic
1105348638 13:19596867-19596889 ATGGAGTGGAGAAATATGGAAGG + Intergenic
1105740207 13:23315813-23315835 TTGGGGAAGAGATATGTGGATGG + Intronic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1106288064 13:28335404-28335426 AGGGAGTGGAGTAATGAGGAAGG - Intronic
1106307729 13:28528223-28528245 ATAGAGCGGGGAAATGGGGAGGG + Intergenic
1106798662 13:33233485-33233507 GTGGAGAGGAGAACTGGAGAAGG - Intronic
1107481027 13:40786458-40786480 ATGGAGAGGAGAAATGTGGAAGG + Intergenic
1107880820 13:44830506-44830528 AAGGAGATGTGAATTGTGGATGG - Intergenic
1107923057 13:45229801-45229823 GGGGAGAGGAGAAAAGAGGAGGG - Intronic
1108487363 13:50940550-50940572 ATGGAGAGATGGAATGTGGGAGG + Intronic
1108523817 13:51268283-51268305 ATGGAAAGGAGTAATGAGAACGG + Intronic
1108623760 13:52208320-52208342 GTAGAGAGGAGAAATGTGGAAGG + Intergenic
1108662956 13:52602711-52602733 GTAGAGAGGAGAAATGTGGAAGG - Intergenic
1109154425 13:58888347-58888369 ATGAAGAACTGAAATGTGGAGGG + Intergenic
1110038329 13:70717574-70717596 ATGGAGATGAGAAACGTGTTGGG + Intergenic
1110268643 13:73568371-73568393 ATGGAGAGAAGAGATGAAGAAGG - Intergenic
1110486614 13:76051955-76051977 GTGTAGAGGAGAAAAGAGGATGG - Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111476263 13:88752360-88752382 ATGGAGAGGAGAAAACTCAAAGG - Intergenic
1112353459 13:98655386-98655408 ATGGAGAGGGGAAGTGCGCAGGG - Intergenic
1112828904 13:103424503-103424525 CTGGAAAGTAAAAATGTGGATGG + Intergenic
1112888649 13:104205598-104205620 ATACAGAGGAGGATTGTGGAAGG + Intergenic
1112946364 13:104931633-104931655 ATGATGTGGAGAAATCTGGAGGG - Intergenic
1113184012 13:107665567-107665589 ATTGAGAGCAGAAATGGAGAGGG - Intronic
1113315712 13:109177112-109177134 AGGAGGAGGAGAATTGTGGAGGG - Intronic
1113902529 13:113804857-113804879 ATGGAGAGGAGACGGGTGGTCGG - Intronic
1115053064 14:29088720-29088742 GTGGAGAGGGGAAATGGGGATGG + Intergenic
1115364145 14:32537468-32537490 ATGGAGATCAGAGATGAGGAAGG + Intronic
1115801276 14:36996691-36996713 ATGGAGAAAAAAAAAGTGGATGG + Intronic
1116249136 14:42458266-42458288 TTGGGGAAGAGATATGTGGAAGG + Intergenic
1116531374 14:45977607-45977629 TTGGAGAAGAGGCATGTGGATGG - Intergenic
1116787881 14:49308041-49308063 AGGGAGGGGAGAAATGTCGAAGG - Intergenic
1117265340 14:54080486-54080508 ATGGGGAAGAGAAATATGGATGG - Intergenic
1117416911 14:55505192-55505214 ATAGAGAGGCTAAATGTAGATGG - Intergenic
1117810936 14:59546318-59546340 ATGGAGGGAAGAAGTGGGGAAGG + Intronic
1118215748 14:63807010-63807032 ATTAAAAAGAGAAATGTGGATGG - Intergenic
1118346232 14:64943047-64943069 ATGGAGAGGAAAAAAAGGGAGGG + Intronic
1118564564 14:67125208-67125230 ATGCAGAGGTGGAATGTGGGAGG + Intronic
1119016639 14:71063819-71063841 ATGGAAATGAGAAATATGAATGG - Intronic
1119193121 14:72697764-72697786 ATGGAGAGGAAAAATGGGGTGGG + Intronic
1119887694 14:78157171-78157193 ATGGAGAGGAGGAAGTAGGAGGG + Intergenic
1120289890 14:82554316-82554338 ATGGATAGCAGAAATGTGCTGGG - Intergenic
1120519310 14:85508202-85508224 AAGGAAAGGAGAAAGGAGGACGG + Intergenic
1120599441 14:86483328-86483350 AGGTAGAGGAAAAATTTGGAGGG - Intergenic
1120717439 14:87854980-87855002 AAGGACAGGAGGAATGGGGAAGG + Intronic
1120988539 14:90354976-90354998 ATGGGGAGGGGAAAGGAGGAGGG + Intergenic
1121206419 14:92172333-92172355 ATTGAGAGGAGAAATGGGTACGG + Intergenic
1121319028 14:92980353-92980375 GAGGAGGGGAGAAAGGTGGAGGG + Intronic
1121425920 14:93852037-93852059 GTGGAGAGAAGAGATGGGGAGGG - Intergenic
1121523122 14:94599838-94599860 GTGGAGAGTAGGGATGTGGAGGG + Intronic
1122063213 14:99150986-99151008 ATGGAGAGCAGACTAGTGGATGG - Intergenic
1124402710 15:29364056-29364078 TTTGAGAGAAGAAATATGGAAGG + Intronic
1125321246 15:38491899-38491921 ATGAAAAGGAAAAATGTGGTTGG - Intronic
1125792046 15:42374335-42374357 AGGGACAGGAGAAATGGAGAGGG + Intronic
1126059189 15:44762453-44762475 AAGGAGAGGAGAAAAGGGGTTGG - Intronic
1126283692 15:46986910-46986932 TTGGGGAAGAGATATGTGGATGG + Intergenic
1126324022 15:47455661-47455683 ATGGTGGTGAGAAATGTGGAAGG - Intronic
1126841762 15:52724305-52724327 ATGGAGCGGAGAAGTTGGGATGG - Intergenic
1126975762 15:54178278-54178300 GTGGAGAGAAGATATGGGGAGGG - Intronic
1127691117 15:61398660-61398682 AGGGAGAGGGGAAAGGTGGAGGG + Intergenic
1127851194 15:62913363-62913385 ATGGAGAGCAGCAAGATGGAGGG - Intergenic
1128031881 15:64488287-64488309 ATGGAGAGGAGAAATGCCAGCGG + Intronic
1128363185 15:66977006-66977028 ATGGAAAGGAGATATTTAGACGG + Intergenic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1129064082 15:72886469-72886491 CTGAAGAGGAGTAATGTGGGTGG + Intergenic
1129088563 15:73123760-73123782 TTTGAGATGAGAAATATGGAGGG - Intronic
1129124245 15:73424291-73424313 ATGGTGAGGAGAAATGCTTATGG + Intergenic
1129249678 15:74302093-74302115 ATGTGGAGGAGACAGGTGGAGGG - Intronic
1129518890 15:76173278-76173300 TTGGAGAGAGGAAATGTGGAGGG + Intronic
1129977749 15:79836638-79836660 AGGGTGGGGAGAAATGGGGATGG + Intronic
1130162634 15:81416402-81416424 AGGGAGAGGAGAAATGTGGTAGG - Intergenic
1130197314 15:81792711-81792733 ATGGATTTGAGAAATGAGGAGGG + Intergenic
1130373360 15:83306084-83306106 CTGGAGAGGAGAAGTGGGGGCGG + Intergenic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1130721201 15:86387051-86387073 ATGGAAAGCAGAAAGGGGGATGG + Intronic
1131321113 15:91392103-91392125 CTGGAGAAGACAAATATGGATGG + Intergenic
1131633653 15:94206802-94206824 ATGGAGATGAGAAGTTTAGAAGG - Intergenic
1131880713 15:96859299-96859321 AGGGAGGGGAGAAATGGGGAAGG - Intergenic
1131949533 15:97666111-97666133 ATGGAGAGGGGAAGAGTGAATGG - Intergenic
1132127154 15:99237873-99237895 TTGAAGAGGAGGAATGGGGAGGG - Intronic
1132799058 16:1742570-1742592 ATGAACAGGAGTAATGAGGATGG + Intronic
1133366721 16:5216142-5216164 ATGGGCAGGAGGAATGTGGGAGG + Intergenic
1133523667 16:6582938-6582960 AAGGAAAGGAGAAAAGAGGAGGG - Intronic
1133530946 16:6654143-6654165 ATGGAGAGGAGATGAATGGATGG + Intronic
1133595261 16:7284952-7284974 TTGGCGAGGAGAAAGGTGGGTGG - Intronic
1133644344 16:7749420-7749442 ATGGAGAGGTGACCTGTCGAAGG - Intergenic
1133670551 16:8014874-8014896 CTGCAGAGGGGAAATATGGAAGG + Intergenic
1134395331 16:13857448-13857470 CTGGATAGTAGAAATTTGGAAGG + Intergenic
1134414080 16:14028863-14028885 ATGGTGAGGAGTAAGGTGAAAGG - Intergenic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1136236261 16:28915426-28915448 AGGAAGCTGAGAAATGTGGATGG - Intronic
1137768070 16:50993018-50993040 AGGGAGAGGAGAAAGGAGAAGGG + Intergenic
1137901280 16:52271900-52271922 TTGGAGAGGATCAATGTGGCAGG - Intergenic
1138487097 16:57352781-57352803 AGGGAGAGGGGTAATGGGGAGGG + Intergenic
1138520300 16:57567283-57567305 AGGGAGATGGGAGATGTGGAGGG + Intronic
1139085196 16:63576338-63576360 AAGCAGATGAGAAATTTGGAGGG + Intergenic
1140092981 16:71852422-71852444 ATGGTGAGGAGAGATGGGGAAGG - Exonic
1140657040 16:77151687-77151709 AAGGAGAGGAAAAATGAGAATGG - Intergenic
1140770938 16:78203400-78203422 ATGGAGAAGAGAAATTTGTTAGG + Intronic
1140789732 16:78379929-78379951 ATGGAGAGGAGAAAAGAAAACGG + Intronic
1141532415 16:84655774-84655796 CTGAAGAGGGGAAATGTGGTTGG - Intronic
1141535384 16:84676248-84676270 CTGGAGAAGAGACATGTGGATGG + Intergenic
1141648363 16:85379313-85379335 ATGGAGAGGAGCAAAACGGATGG - Intergenic
1141729910 16:85815188-85815210 CTGGGGAGGGGAAATGGGGAGGG - Intergenic
1142108694 16:88319619-88319641 ATGGGGAGGAGAAGGGTGGCAGG - Intergenic
1142520894 17:503846-503868 AAGGAGAGGAGAGCTGGGGAAGG + Intergenic
1142708675 17:1711294-1711316 GTGGAGTGGAGTAAGGTGGAAGG - Intergenic
1142823331 17:2490111-2490133 ATGCAGAGGAAAAGTCTGGAAGG + Intronic
1142854045 17:2720180-2720202 GTGGAGAGGAGAAGATTGGAAGG - Intergenic
1143305943 17:5946801-5946823 GTGGAGAGGAGAAGGATGGAGGG + Intronic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1144083573 17:11786406-11786428 ATGGAAAGGAGAGATGAGGTTGG + Intronic
1144445730 17:15326356-15326378 ATGAAGCTGAGAAATGAGGAGGG + Intronic
1145030047 17:19497920-19497942 TTTGAGAGGAGAAATGAGAAAGG + Intronic
1146320895 17:31845525-31845547 ATGGAGAGGAGAATGAAGGAGGG + Intergenic
1146484474 17:33231853-33231875 ATTGAGATGAGCAATGGGGAGGG + Intronic
1146526324 17:33570004-33570026 GTGGAGAGGAGTGATGGGGAGGG - Intronic
1146555949 17:33824110-33824132 AGGGAGAGGAGCAATGGGGATGG + Intronic
1147113939 17:38284690-38284712 AGGGAGAGCACAAATTTGGAGGG + Intergenic
1147232055 17:39026933-39026955 TTGGAGAGCAGAACTGAGGACGG + Intergenic
1148068867 17:44894626-44894648 CTGGAGAGGAGGCATGTGAAAGG - Intronic
1148217937 17:45844075-45844097 ATGGAGAGGAAGAAAGTGAAGGG - Intergenic
1148415667 17:47504501-47504523 AGGGAGAGCACAAATTTGGAGGG - Intergenic
1148587356 17:48790502-48790524 GTGGAGGGGAGACATGTGGGAGG + Intronic
1148628663 17:49089889-49089911 CTGGAGAAGACATATGTGGATGG + Intergenic
1148722831 17:49766859-49766881 AGAGAGAGGAGTAATGTGCATGG + Intronic
1150118560 17:62578232-62578254 ATGGAGAGGAGGGAGGAGGAGGG + Intronic
1151353697 17:73546165-73546187 AGGGAGGGGAGAAAGGCGGAGGG - Intronic
1151446715 17:74170969-74170991 CTGGGAAGGAGGAATGTGGATGG + Intergenic
1152099457 17:78292520-78292542 ATGGAGAGGGCAGATGAGGAGGG - Intergenic
1152134019 17:78493681-78493703 AGGGAGTGGTGACATGTGGAGGG - Intronic
1152948461 17:83211611-83211633 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1152948495 17:83211732-83211754 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1203212040 17_KI270730v1_random:86701-86723 ATGGAGAGGAGTGGAGTGGAGGG + Intergenic
1153069756 18:1091731-1091753 ATGGAGGGAAGAAATGGGGAAGG - Intergenic
1153330417 18:3867666-3867688 GTTGGGAGGAGAAATGGGGATGG + Intronic
1153950749 18:10055718-10055740 ATGTTGAAGAGAAATTTGGAAGG + Intergenic
1154084575 18:11290519-11290541 AGGGAGAGAAGAAATGCTGAAGG - Intergenic
1154341954 18:13510858-13510880 ATGGAGAGGATTAATGTGGCTGG + Intronic
1155489006 18:26380260-26380282 ATGTAGAAAAGAAATGTGTAAGG - Intronic
1155742957 18:29313176-29313198 TTGGAGAGTAGAAATGAGGCAGG + Intergenic
1156861368 18:41840095-41840117 ATAGAGAGCAGAATTCTGGAAGG - Intergenic
1157220406 18:45825253-45825275 AGGGAGAGGAGAAGGGAGGATGG + Intergenic
1157405492 18:47419270-47419292 ATGAAGAGGAGATAGGGGGAAGG + Intergenic
1157615490 18:48985005-48985027 ATGGAGAGGAGAAATAGGAGAGG + Intergenic
1157627236 18:49060863-49060885 ATGGAGAGGAGAGAAGTGTAAGG + Intronic
1157748437 18:50157567-50157589 GGGGAGAAGAGAAATGTGGCTGG - Intronic
1157992433 18:52512947-52512969 GTGGAGAGAAGAAATGAAGATGG + Intronic
1158424894 18:57330131-57330153 ATGGAGAGAACACATGTAGAGGG - Intergenic
1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG + Intergenic
1160067181 18:75586574-75586596 ATGGAGAGGAGAGAGGAGGGAGG - Intergenic
1160244333 18:77145072-77145094 ATGCAGAGAAGAAATGGGTATGG - Intergenic
1160322053 18:77905505-77905527 ATGGACAGGTGGAAGGTGGAAGG + Intergenic
1162038322 19:7954316-7954338 AAGGAAAGGAAAAATGTGCAGGG - Intergenic
1162226309 19:9225512-9225534 AAGGAGAGGGGAATTGAGGATGG + Intergenic
1162835455 19:13314188-13314210 ATAGAAAGGAGAGATGAGGAGGG + Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1164529676 19:29038849-29038871 ATGGCTAGGAGGAATATGGATGG - Intergenic
1164590413 19:29503868-29503890 CTGGAGAGGAGTCATGGGGACGG - Intergenic
1164868735 19:31625980-31626002 AGGGGGAGGAGAAAAGTGAAGGG - Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165725082 19:38107080-38107102 GTGGAGGTGAGAAATGGGGAAGG - Intronic
1165974758 19:39665982-39666004 ATGTGGAAGGGAAATGTGGAAGG - Intergenic
1167092011 19:47350929-47350951 ATGGAGTGGAGAGAGATGGAGGG + Intronic
1167210822 19:48133156-48133178 ATGGAGAGGAGAACTGCTAATGG + Intronic
1167651141 19:50729671-50729693 AGGGAGGGGAGAAAAGGGGAGGG + Intergenic
1168405943 19:56110790-56110812 GTGGAGAGGAGGGGTGTGGAGGG - Intronic
925264606 2:2558191-2558213 ATGGAGAGAGGAAATGTGGCTGG + Intergenic
925476435 2:4221916-4221938 CTGGAGAAGAGAGATGGGGAAGG + Intergenic
927197153 2:20555879-20555901 ATGCAGAGGTGAAGTGGGGAAGG - Intergenic
927446349 2:23165452-23165474 ATGCAGGGGAGAAATGAGGTCGG + Intergenic
927855824 2:26527471-26527493 CTGGAGAGGCGAAAGGTGGAGGG - Intronic
927862851 2:26570925-26570947 AGGGAGAGGTCAGATGTGGAGGG + Intronic
928076440 2:28269274-28269296 ATGGAGAGGAGAAGGGGGAAGGG - Intronic
928183805 2:29091285-29091307 ATTGCGAAGAGAAATGTGAATGG - Intergenic
928843766 2:35644045-35644067 TTGGACAGAAGCAATGTGGAAGG + Intergenic
929085620 2:38164724-38164746 CTGGAGAGGAGAGATGAAGAGGG - Intergenic
930110941 2:47678008-47678030 ATGGTGTGGAGAAATGGGGATGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
932153100 2:69390863-69390885 TTGGAGAGGAGTATTGGGGAGGG - Intergenic
932274338 2:70440797-70440819 AAGGAGAGGAGAAAGATGGGAGG - Intergenic
932543381 2:72680817-72680839 ATGGTGTGGTGAAATGGGGATGG - Intronic
933011153 2:77065260-77065282 ATAGAGATGAGAAAAGTGCATGG - Intronic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933639652 2:84745874-84745896 ATGGAGAGGAGACATTTGAAGGG + Intronic
934901784 2:98165581-98165603 AGTTAGAGGAGAAATGGGGATGG + Intronic
935580302 2:104750497-104750519 AGGGAGAGGAGAAAGGGAGACGG - Intergenic
935660221 2:105460464-105460486 ATGGAGAAGAAAAATGTAGGAGG + Intergenic
935829413 2:106985063-106985085 TTGGACAGGGGAAATGTGAAGGG + Intergenic
935867522 2:107406638-107406660 ATGCAGAGTAGAAATGAGGCTGG - Intergenic
936445786 2:112594098-112594120 AAGAAGAGTAGAAATGTGGAGGG - Intergenic
936708182 2:115100786-115100808 ATGGAAATTAGATATGTGGATGG - Intronic
936844624 2:116816036-116816058 ATGGAAGGGAGAAAAGGGGAGGG + Intergenic
937633841 2:124133558-124133580 CAGGAGAGGAGACATGTGGGTGG - Intronic
937800460 2:126075754-126075776 TTGGAGAAGAGGTATGTGGATGG + Intergenic
937887221 2:126908150-126908172 ATGGGGAGGACGAATGTGGTGGG + Intergenic
938189154 2:129258805-129258827 ATGTAGAGGAGGAGTGTGGAGGG + Intergenic
939155967 2:138524738-138524760 ATGGAGATGAGGAATGTGTTAGG - Intronic
939340974 2:140895733-140895755 ATGGAGAGCTGAAAAGGGGATGG + Intronic
939496681 2:142934517-142934539 ATAGGGAGCAGAAAAGTGGAGGG + Intronic
939596907 2:144136442-144136464 AAGGAAAGGAGAAAGGAGGAAGG + Intronic
940101803 2:150048640-150048662 AGGGAGATGGGAGATGTGGAAGG + Intergenic
940132427 2:150397485-150397507 ATAGAGAGTAGAATGGTGGAGGG - Intergenic
940195250 2:151087300-151087322 ATGCAAGGGAGAAATATGGAAGG + Intergenic
940917710 2:159275327-159275349 CTGGTGAGCAGAAATGTGCATGG + Intronic
941142980 2:161807547-161807569 ATGGATAGAAGAAAAGTAGAGGG - Intronic
941880578 2:170476487-170476509 ATGGAGAGCTGGAATGGGGATGG + Intronic
943332260 2:186573523-186573545 ATTAAGAGGAAAAATGAGGAAGG + Intergenic
944994245 2:205276191-205276213 AGGGGAAGTAGAAATGTGGATGG + Intronic
945042780 2:205755885-205755907 AGGGTGAAGAGAAAGGTGGATGG + Intronic
945454650 2:210036105-210036127 AGGGAGATGAGAAATGGGCAAGG - Intronic
945544040 2:211126773-211126795 AGAGAGAGGAGAAAGGAGGAAGG - Intergenic
945766054 2:213978999-213979021 AAAGAGAGGAGAAATAAGGACGG + Intronic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946353242 2:219169121-219169143 ATGGAGAAGAGAAGGGTGAATGG + Intronic
946408909 2:219506908-219506930 ATGCCGGGGAGCAATGTGGATGG + Exonic
946444589 2:219727378-219727400 AGGGAGTGGAGAAAGCTGGAGGG + Intergenic
946759886 2:222982998-222983020 ATGGAGACGGGAAGTGGGGAAGG - Intergenic
947958230 2:234213123-234213145 ATGGAGAGGGGAATGGTGTATGG + Intergenic
948081738 2:235212120-235212142 AAGGAAAGGAGAAAGGGGGAGGG - Intergenic
948381193 2:237551041-237551063 ATGGCGGGGAGAAATGTGAAGGG - Intronic
948748259 2:240111013-240111035 ATGGCGTGTAGAAATGAGGAAGG + Intergenic
1169235385 20:3926051-3926073 ATGGAGAGGGGAGAAGTGGATGG + Intronic
1169564959 20:6843860-6843882 ATGAAGAGGACCAATGTGAAGGG - Intergenic
1169620498 20:7501402-7501424 ATGGTCAGGAGAAATCTGCATGG - Intergenic
1170394842 20:15915183-15915205 ATGGAGAGGAGAGAAGTGCTGGG - Intronic
1170876366 20:20253977-20253999 ATGGAGAGGAGAGGAGGGGAGGG - Intronic
1171001672 20:21421966-21421988 AGGGAGAGGAGAAGAGCGGAAGG - Intergenic
1171077036 20:22137838-22137860 GTGCAGAAGGGAAATGTGGATGG - Intergenic
1171322382 20:24257921-24257943 CTACAGAGGAGAAATGTGGATGG + Intergenic
1172204539 20:33153613-33153635 ATGAAAGGAAGAAATGTGGATGG + Intergenic
1172898328 20:38316220-38316242 ATGGAGGGAAGAAAAGGGGAAGG - Intronic
1173284718 20:41659814-41659836 ATGGAGGTGAGAGATGAGGATGG - Intergenic
1173357098 20:42303773-42303795 CTGGAGATGAGAAAAGTGCATGG + Intronic
1173754328 20:45501779-45501801 CTGTAGAGAAGAAATGTGTAAGG + Intergenic
1173916391 20:46711320-46711342 ATGGAGAGGAGAAGCTGGGAAGG + Intronic
1174265800 20:49331038-49331060 ATGGAGAGTTGACAAGTGGATGG - Intergenic
1175062786 20:56258927-56258949 GTGGAGAGAAGAAATGAGGAGGG + Intergenic
1175093685 20:56524788-56524810 ATGGTGAGCAGAGATGGGGAAGG - Exonic
1175094875 20:56533321-56533343 ATGGTGAGCAGAGATGGGGAAGG - Exonic
1175298941 20:57929053-57929075 ATCAAGAGGAAAAAAGTGGAAGG + Intergenic
1175461719 20:59156659-59156681 TAGGGGAGGAGAAATGGGGAAGG - Intergenic
1175890596 20:62314200-62314222 ATGGAGAGGTGAAGGGTGGTGGG + Intronic
1175935126 20:62510636-62510658 ATGGAGAGGTGGAGGGTGGAGGG - Intergenic
1176529004 21:7943684-7943706 ATGGAGAGGAATAAAGTGGAAGG - Intergenic
1176636552 21:9249055-9249077 ATGGAGTGGAGTAGAGTGGAAGG + Intergenic
1176657779 21:9603230-9603252 ATGGAGAGGAGGAATTTGTTGGG - Intergenic
1176757768 21:10738416-10738438 GTGGAGAGGAGAGGTGTGGAGGG - Intergenic
1176998245 21:15580809-15580831 TTGGGGAAGAGATATGTGGATGG + Intergenic
1176998257 21:15580897-15580919 TTGGGGAAGAGATATGTGGATGG + Intergenic
1177067862 21:16463459-16463481 ATGGAGATGAGGAATGTGTTGGG + Intergenic
1177504436 21:22001690-22001712 ATGGAGATGAGAAATTTGTTGGG - Intergenic
1177576849 21:22968332-22968354 ATGGAAAGGAGCCATGTGTAAGG - Intergenic
1177618557 21:23556951-23556973 ATGTAGTGGTGGAATGTGGAAGG - Intergenic
1177698900 21:24610778-24610800 ATTGAGAAGAGAACTGTGGTAGG - Intergenic
1178123556 21:29493837-29493859 ATTGAGGGGAGAAGTCTGGAAGG + Intronic
1178469105 21:32875813-32875835 ATGGAGATGAGAAATTTGTTGGG - Intergenic
1178478986 21:32962860-32962882 ATGGTGAGGTGAAGGGTGGATGG - Intergenic
1179084849 21:38207579-38207601 GAGGAGAGGAGAAAAGAGGAGGG - Intronic
1179189728 21:39113558-39113580 ATGGACAGAGGTAATGTGGATGG + Intergenic
1179403771 21:41108705-41108727 AGGGAGAGGAGAGAGGTGGAGGG + Intergenic
1179572548 21:42286536-42286558 ATGGAGAGGAGACAGGGCGAGGG + Intronic
1180923182 22:19533088-19533110 AAGGAGAGGAGAAAGGGGGTGGG + Intergenic
1181744534 22:24946643-24946665 AAGGAGAGGAGAATTGTATAAGG - Exonic
1181794906 22:25300431-25300453 TTGGAGAAGAGATATATGGAGGG + Intergenic
1181885311 22:26017379-26017401 AGGGAGAGGAGGAAGGAGGAGGG - Intronic
1181912862 22:26254342-26254364 AGGAAGAGGAGAAGTGAGGAAGG + Intronic
1182055934 22:27354606-27354628 ATGGAGAGAAGAGAGATGGATGG - Intergenic
1182320513 22:29475925-29475947 AGGGAGAGGAGAAAAAAGGAGGG + Intergenic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182458215 22:30466085-30466107 ATGGACAGGAGAAATAAGGGAGG + Intronic
1182529532 22:30944642-30944664 ATGAAGAGGGGAAGTATGGAGGG - Intronic
1182760514 22:32718879-32718901 ATGTAGAGGAGAAATGGGACAGG - Intronic
1182990068 22:34759182-34759204 ATGGATAGGAAGAAAGTGGAAGG + Intergenic
1183159925 22:36106049-36106071 AAGGAGAGGAGAAAAGTGGCAGG - Intergenic
1183596951 22:38818603-38818625 AGGGAGAGGAGAAAGGGGCAAGG + Exonic
1183806423 22:40215372-40215394 ATGGCAATGAGAAATGTGGCTGG - Intronic
1185009666 22:48306045-48306067 GTGGACAGGTGAGATGTGGATGG + Intergenic
1185009685 22:48306098-48306120 GTGGACAGGGGAGATGTGGATGG + Intergenic
1185021842 22:48381089-48381111 ATGGACAGGTGAAATGCAGATGG + Intergenic
1203308925 22_KI270736v1_random:128916-128938 ATGGAGAGGAGGGGAGTGGATGG + Intergenic
949155931 3:827267-827289 ATGGAGAGGAAAAAGTGGGAAGG + Intergenic
950051238 3:9991387-9991409 ATGAAGAGAAAAAATTTGGAAGG - Intronic
950078074 3:10201436-10201458 ATGGAGGGGAGGAAAGTGGTGGG - Intronic
951689958 3:25385083-25385105 AAAGAGAGGACAAGTGTGGAGGG - Intronic
951786677 3:26428203-26428225 ATGGAAAGGAGAAAGCTAGAAGG - Intergenic
951823446 3:26840505-26840527 CTGGGGAGGAAAAAAGTGGAGGG - Intergenic
951853698 3:27170921-27170943 ATGGAGAGGAGAAATGAGAGAGG - Intronic
952519264 3:34139083-34139105 GTGGAGAGGAGAAAGGCAGAAGG - Intergenic
953483755 3:43275099-43275121 ATAGAAAGGAGAAAAGAGGAGGG - Intergenic
953666157 3:44927937-44927959 AAGGAAAGGAGAAAGCTGGAGGG - Intronic
954784779 3:53084805-53084827 AGGGAGAGAAGAAATGTGACAGG + Intronic
955159190 3:56447431-56447453 AGGGAGACGAGAAGTGGGGAAGG + Intronic
955227388 3:57072345-57072367 AAAGAGAGGAGAAATGTATACGG + Intronic
955677788 3:61467170-61467192 ATGGTGAGGAGAGACATGGATGG - Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956345651 3:68275260-68275282 ATGTTGGGGAGAAATATGGAGGG + Intronic
956509749 3:69981002-69981024 TTGGGGAGGAGGTATGTGGATGG + Intergenic
956576725 3:70760322-70760344 ATGGAGGTGATAAAGGTGGACGG + Intergenic
956997014 3:74838151-74838173 ATGAAAAGGAGAAATGTGGTGGG + Intergenic
957683413 3:83469638-83469660 AAGGAGAGGAGAGAAGAGGAGGG + Intergenic
958678065 3:97292624-97292646 ACGGAGAGGAGACCTGTGGTGGG + Intronic
958678112 3:97292902-97292924 GTGGAGAGGAGACCTGTGGTGGG + Intronic
958765832 3:98367259-98367281 ATGGAGAGCTGAAATGTTCACGG + Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
958934393 3:100241242-100241264 TTGGGGAAGAGATATGTGGATGG + Intergenic
959157111 3:102680121-102680143 TTGGCAAGGGGAAATGTGGAGGG - Intergenic
959369061 3:105500275-105500297 AAGGAGATGAGAAAAGAGGAAGG - Intronic
959608922 3:108272191-108272213 ATGAAGAGGATAAATGTGTTAGG + Intergenic
960358178 3:116678771-116678793 ATGGAGAGCTGGAATGGGGATGG - Intronic
960378434 3:116931190-116931212 ATAGAGAGAAAAAGTGTGGAGGG + Intronic
961022989 3:123525219-123525241 TTGGAAAGGAAAAAGGTGGATGG + Intronic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961187374 3:124927477-124927499 ATGGAGAGTACAATTGTGGAGGG - Intronic
961472253 3:127122915-127122937 CTGGGGAGGAGATATGTGGGCGG + Intergenic
961485757 3:127214680-127214702 AAGGAGAGGAGAAAGGTGGGGGG + Intergenic
961695024 3:128698500-128698522 TTGGCGGGGAGAAATGCGGAGGG + Intergenic
962221608 3:133569062-133569084 CTGGAGAGTAGAAAAGAGGAAGG - Intergenic
963764132 3:149316116-149316138 ATGGAGAGGAGAAAAGATGCAGG + Intergenic
964154164 3:153564453-153564475 ATGGAGAGGAAATGTGTGGTTGG + Intergenic
964233257 3:154495482-154495504 AGGGAGAGGAGAAATGAGAACGG - Intergenic
964995689 3:162877155-162877177 TTTAAGAGGAGAAATCTGGATGG - Intergenic
966281522 3:178235875-178235897 ATGGAAACCAGAAATGTGAATGG - Intergenic
966307099 3:178548671-178548693 AGGAAGAGGAAAAATGTGAAAGG - Intronic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
967953356 3:194857938-194857960 AGGGAGAGAAGAAATGAGGCAGG - Intergenic
968181107 3:196596110-196596132 ATGGAGGGGAGAAGTGTGGGTGG - Intergenic
969193520 4:5542970-5542992 GTGGAGGGGAGAAGTGTGGGAGG - Intronic
969509596 4:7610255-7610277 GTGGAGAGGACACATGTGGCAGG - Intronic
969940367 4:10725542-10725564 CTGGGGAGGGGAAATGGGGATGG - Intergenic
970122063 4:12765921-12765943 AAGTAGAGGGGAAATATGGAAGG - Intergenic
970811649 4:20101288-20101310 ATGGAGATGAGAAATTTTCAGGG + Intergenic
971127501 4:23770510-23770532 CTGGAGCGGAGACATGTGGATGG - Intronic
972279076 4:37585508-37585530 GGGGAGAGGAGAAATGTTGAGGG + Intronic
972662613 4:41130757-41130779 ATGGGGAGCAGAAGTGGGGAGGG - Intronic
972770534 4:42193209-42193231 CAGGAGAGGAGGAAAGTGGAAGG - Intergenic
972812968 4:42610625-42610647 ATGGAGAGGAGATATTTGTGGGG - Intronic
974059548 4:57018886-57018908 ATGGTGAAGAGAAATCTGAAGGG + Intronic
974201066 4:58641279-58641301 AAGGAGATGAGAAAGGTGTATGG - Intergenic
974600814 4:64076762-64076784 ATGGGGAGGAATAATGTGGATGG + Intergenic
975318725 4:72984976-72984998 TTAGAGAGGAGAAAGGTGAAGGG - Intergenic
975757006 4:77580830-77580852 AGGGAGAGGGGAAAGGAGGAGGG - Intronic
976017020 4:80568692-80568714 ATGGAGAGGAGAAAGAAGAAAGG + Intronic
976183229 4:82419211-82419233 ATGGAGAGAAGAAATTTAAAGGG + Intergenic
977068768 4:92354824-92354846 ATGGAGATGAGAAATCTTAAGGG + Intronic
977853742 4:101861893-101861915 ATGGAGAGGCCAAATGTATAAGG - Intronic
978685362 4:111435840-111435862 TTGGAGAAGAGGAATGTGGCTGG - Intergenic
978764486 4:112390235-112390257 ATGGAGAGCAGCTATGTGCATGG - Intronic
978769022 4:112434223-112434245 ATTGAGAGAAGAAAAGAGGAAGG - Intronic
978849191 4:113312665-113312687 ATGGTGAGGAAAAGTGGGGAGGG + Intronic
979736517 4:124092499-124092521 TTGGAGAGGAGAAATGCAGGAGG + Intergenic
980663516 4:135898799-135898821 ATGGAAATGAGAAATGTACAGGG + Intergenic
980808173 4:137840316-137840338 AGGAAGTGGAGAAATGGGGAGGG + Intergenic
980999420 4:139814283-139814305 TTGGAGAGCAGAAATCAGGATGG + Intronic
981217410 4:142186979-142187001 ATGGAGAAGAGAAACCTGGTGGG + Intronic
981308102 4:143267934-143267956 ATGGGGAAGAGAAATGTGGTTGG + Intergenic
981463923 4:145044432-145044454 ATAGAAAGGAGAATTTTGGAGGG - Intronic
982010630 4:151102626-151102648 ATGGAGGGTAGAAAGGAGGAGGG + Intronic
982300995 4:153879406-153879428 CTGGGGAAGAGATATGTGGATGG + Intergenic
982575926 4:157110047-157110069 AGGGAGGGGAGAAAGGTTGAAGG - Intronic
982718300 4:158832057-158832079 TTGTGGAGGAGAACTGTGGAGGG - Exonic
983335997 4:166393238-166393260 ATGGAGAGGAAAAATGGGGTTGG - Intergenic
983649000 4:170020220-170020242 AGGTACAGCAGAAATGTGGAAGG - Intronic
983671592 4:170244168-170244190 ATGGAAAGAAGAAATGGGGTGGG - Intergenic
984131350 4:175879087-175879109 ATGGAGATGAGAAATTTGTTGGG - Intronic
984208006 4:176809907-176809929 CTGGAAAGGAGGAAAGTGGATGG - Intergenic
985138307 4:186812044-186812066 ATGGGGAGCTGAAAGGTGGATGG + Intergenic
985331442 4:188841151-188841173 ATGGAAAAGAGAGATGTGGAGGG + Intergenic
985417631 4:189752856-189752878 ATGGAGAGGAGGAATTTGTTGGG + Intergenic
985514958 5:337677-337699 GGGGAGAGGAGAACTCTGGATGG + Intronic
985525177 5:397959-397981 ATGGTCAGGAGCTATGTGGATGG - Intronic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986163212 5:5250008-5250030 ATCGAGAGGAGAAAAGTAGCTGG - Intronic
986187670 5:5459944-5459966 TTGGGGAGGAGATATGTGGTGGG + Intronic
987068072 5:14308900-14308922 ATGGACTAGACAAATGTGGATGG - Intronic
987250983 5:16101127-16101149 ATGGAGAGATGAGATGTGGATGG - Intronic
987466172 5:18274900-18274922 TTGGAGAAGAGGTATGTGGATGG - Intergenic
987557446 5:19472635-19472657 ATGGAGAAAAGAACTGGGGAGGG + Intergenic
987944892 5:24593424-24593446 CTGGAGAGCAGAAATGTGGCAGG + Exonic
988061376 5:26175020-26175042 ATGGAGAGGAGAAACTTGTTGGG + Intergenic
988395201 5:30688287-30688309 AAGGAGAGTAGAAATGTGAAAGG - Intergenic
988686907 5:33534323-33534345 AGGGAGTGGAGAAAGCTGGATGG - Intronic
988948310 5:36230206-36230228 ATGGGGAGGAAAAATGAGGTAGG - Intronic
989183870 5:38604271-38604293 GTGGAGAGGAGAAAGGGGCAAGG + Intronic
989185526 5:38621635-38621657 ATGGAGCTGAGATATGAGGAAGG - Intergenic
989238978 5:39181789-39181811 ATGGAGATGAGAAAAGAGGTTGG - Intronic
990176545 5:53114478-53114500 AAGGAGAGCAGAAAAGGGGATGG + Intergenic
990343096 5:54844369-54844391 ATGAGGATGAGATATGTGGATGG - Intergenic
991480852 5:67077550-67077572 ATGGTGAGGAGCAAAGTGGATGG - Intronic
991544636 5:67767810-67767832 ATAGAGATGATAAATGGGGATGG + Intergenic
992012735 5:72545445-72545467 ATGGAAAGGGGAAAAATGGAAGG - Intergenic
992068985 5:73132358-73132380 AAGAAGAGGAGAAAAGAGGAGGG - Intergenic
992083721 5:73259384-73259406 CTGGAGAGGAGAGATGCTGAGGG + Intergenic
992399711 5:76401568-76401590 ACCCAAAGGAGAAATGTGGAAGG - Intergenic
992592696 5:78311668-78311690 ATGGAGTGGTGAAATGTGGGGGG - Intergenic
993071198 5:83166181-83166203 ATGGATAAGAAAAATGTGGCCGG - Intronic
993203479 5:84848171-84848193 TTGGGGAAGAGATATGTGGATGG + Intergenic
993231825 5:85246909-85246931 TTGGTGAAGAGATATGTGGATGG - Intergenic
993278274 5:85890704-85890726 AAGGATAGAAGAAGTGTGGAAGG + Intergenic
993278277 5:85890724-85890746 AGGGACAGAAGAAGTGTGGAAGG + Intergenic
993322468 5:86489069-86489091 ATGGAGAGGAGAATGAGGGAGGG + Intergenic
993462430 5:88200173-88200195 ATGGAGGTAAGAAATGGGGATGG + Intronic
993791865 5:92219538-92219560 TTGGAGAAGAGTTATGTGGATGG + Intergenic
994209308 5:97070466-97070488 ATGGAGAGGTGAATTGTTGTTGG - Intergenic
994709972 5:103255331-103255353 CTGAGGAGGAGAAAGGTGGAAGG - Intergenic
994749698 5:103722328-103722350 ATGGAGATGAGAAATGTGTTGGG - Intergenic
994867220 5:105290921-105290943 ATGGAGAAAAGAAATGTAGATGG - Intergenic
995062930 5:107831107-107831129 GGGGAGAGGAGGAGTGTGGAAGG - Intergenic
995180231 5:109224151-109224173 ATGGAGAAGAGAACTCTTGAAGG - Intergenic
995323099 5:110859375-110859397 TTAGAGAGGGGAAATGTAGAGGG - Intergenic
996277825 5:121689043-121689065 ATGAAGAGCAAAAATGGGGAAGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997153296 5:131523594-131523616 ATGGAGAGGAAAAAAGGTGAAGG + Intronic
998079384 5:139261959-139261981 AGGGAGGGAAGAAATGAGGAAGG + Intronic
998394686 5:141811298-141811320 GTGGAGATGAGAAATTGGGATGG - Intergenic
998640282 5:144002593-144002615 ATTGAGAGGAGAGATTTGGAGGG - Intergenic
998889457 5:146730448-146730470 GTGGAGACGTGAAATTTGGAGGG + Intronic
999541363 5:152576023-152576045 ATGGTGAGGAGGAATGGGAAGGG + Intergenic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1000932708 5:167271195-167271217 ATGGTGAGGAGGAGTGGGGAGGG + Intergenic
1001196627 5:169678920-169678942 ATGGAGAAGAGAAACTCGGAGGG + Intronic
1001473470 5:172032457-172032479 ATGAAGATGAGAAATGTGTTGGG - Intergenic
1002460356 5:179370237-179370259 ATGGATAGAAGAAATGAGAAGGG - Intergenic
1002598454 5:180339573-180339595 AAGGAGTGGAGGAATCTGGAAGG - Intronic
1002742628 5:181444766-181444788 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1002742662 5:181444887-181444909 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1003061939 6:2870447-2870469 AGGGAGAGGAGAGGTGTAGAGGG - Intergenic
1003277534 6:4665221-4665243 ATGGTGAGTAGAAAGGGGGAAGG - Intergenic
1003417795 6:5928427-5928449 ATTGAGAGGAGAAATATGCTAGG + Intergenic
1003460080 6:6320867-6320889 ATGGGGAGGAGAAGTGGGAATGG - Intronic
1004100804 6:12608996-12609018 CTGGAGAAGAGAAATGGGGTTGG + Intergenic
1004114262 6:12750424-12750446 AAGGAGAGAAGAAATGAGAAGGG + Intronic
1004500502 6:16205822-16205844 AGGGAGAGGAGAAGAGGGGATGG - Intergenic
1004764065 6:18704628-18704650 ATGGAGGGGAGAAAGCGGGAAGG - Intergenic
1004824205 6:19402603-19402625 TTGGGGAAGAGATATGTGGATGG - Intergenic
1005614349 6:27558356-27558378 AACGGGAGGAGAATTGTGGAGGG - Intergenic
1005676190 6:28157812-28157834 AGGGAAAGTAGAATTGTGGAGGG + Exonic
1005774638 6:29117355-29117377 ATGGGGAGGAGAAATTTACAGGG - Intergenic
1005825266 6:29628264-29628286 GAGGGGAGGAGAAATGGGGACGG + Intronic
1006137297 6:31902709-31902731 ATGGAGTGGAGGAAAGTTGAGGG - Intronic
1006390820 6:33757257-33757279 AAGAAGAGGAGAGAGGTGGATGG - Intergenic
1006824823 6:36927028-36927050 ATGGGGAGGGGAAAAGTGAAAGG - Intronic
1006911438 6:37566094-37566116 ATGGAGCGGAGAGACGGGGAGGG - Intergenic
1007236857 6:40396643-40396665 ATGAAGAGCAGAAAGGCGGAAGG + Intronic
1007339432 6:41181149-41181171 ATGGAGAGAAGAAGGGTGGGAGG - Intergenic
1007601338 6:43083544-43083566 ATGCAGAGAAGAAAAGAGGATGG - Intronic
1007961807 6:45967037-45967059 CTGGAGAGAACAAATGTGGTTGG - Intronic
1007995812 6:46306497-46306519 ATGGTAAGGAGAGATGAGGAGGG + Intronic
1008047984 6:46871391-46871413 TGGGAGAGGAGGAATGAGGAAGG + Intronic
1008291175 6:49717606-49717628 AGGGAGAGGAGAAATGTCAGAGG - Intergenic
1008340188 6:50355003-50355025 AGCAAGAAGAGAAATGTGGAAGG + Intergenic
1008507894 6:52248504-52248526 ATGGAGGGGAGCAGGGTGGATGG - Intergenic
1009697963 6:67134196-67134218 AGGGAGAGGAGAAAGGGGGTAGG + Intergenic
1010244127 6:73647256-73647278 ATAGAAAGGAGAAGTGTGAAGGG + Intronic
1010431639 6:75784463-75784485 ATGGAGAAGAGCAAAGTGAAAGG + Intronic
1010810156 6:80291186-80291208 AGGGAGGGGAGAAATGTCAAAGG - Intronic
1010813532 6:80327892-80327914 AGGGAGGGGAGAAAAGGGGAGGG - Intronic
1010818713 6:80389036-80389058 TTGGGGAAGAGATATGTGGATGG + Intergenic
1010930039 6:81790697-81790719 ATGGAGAGAAGAAAGGTGACAGG + Intergenic
1011734988 6:90301584-90301606 ATGCATAGGAAAAATCTGGAAGG + Intergenic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012690572 6:102306429-102306451 ATGGATAGGGGAATTGGGGATGG + Intergenic
1012788253 6:103658985-103659007 ATGGAGATGAGAAATTTGTTGGG - Intergenic
1013396665 6:109747669-109747691 ATGGGGAGGATACATGTGAAAGG + Intronic
1013535098 6:111056718-111056740 TTGTTGAAGAGAAATGTGGATGG - Intergenic
1014645590 6:123968760-123968782 ATGGTGAGCAGAAATTTGTAAGG - Intronic
1014849187 6:126320108-126320130 AGAGAGAGGAGAAAGGCGGACGG - Intergenic
1014908555 6:127061098-127061120 AGGGAGAGGAAAAATGGGTAAGG + Intergenic
1015239518 6:131007674-131007696 ATGGAGATGAGGAATGTGTTGGG + Intronic
1015475837 6:133658113-133658135 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1017102728 6:150862972-150862994 ATGGATTGGTGAAAAGTGGATGG - Intergenic
1018870151 6:167776597-167776619 ATTGGGAAGAGAAATGTGTATGG - Intergenic
1019247763 6:170720505-170720527 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1019247797 6:170720626-170720648 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1019474897 7:1239676-1239698 TTGGAGATGAGAAATGGAGATGG - Intergenic
1019625486 7:2013786-2013808 GTGTAGATGAGAAGTGTGGATGG + Intronic
1019730609 7:2627486-2627508 ATGGAGGGAAGGAAGGTGGAAGG + Intergenic
1020011496 7:4808020-4808042 AAGGAGCGGAGAAAGATGGAGGG - Intronic
1020362593 7:7344970-7344992 ATGGACAGGAGAAATGAGTTTGG + Intergenic
1020396806 7:7726139-7726161 TTGGGGAAGAGATATGTGGATGG + Intronic
1020577823 7:9956620-9956642 TAGGAGAGGAAAAAGGTGGATGG + Intergenic
1020678845 7:11211877-11211899 ATGGAACTGAGAAGTGTGGAAGG - Intergenic
1021337273 7:19419347-19419369 GAGGAGATGAGAAATGTTGATGG + Intergenic
1021506689 7:21393268-21393290 ATGAAGAGCAGAAATCTGAATGG + Intergenic
1021598681 7:22342763-22342785 ATGGAGACGAGGAATGTGTTGGG - Intronic
1022203769 7:28143122-28143144 AAGGAGATGAGAGTTGTGGAAGG - Intronic
1022218731 7:28291058-28291080 ATGGAAAGAAGAAATGAGGCTGG - Intergenic
1023775295 7:43599969-43599991 TTGGAGAGAAGAAATATAGAAGG - Intronic
1024175849 7:46840398-46840420 GTGGAGAGGTGGAGTGTGGAGGG - Intergenic
1024534719 7:50420569-50420591 ACGGAGAGGAGAGAGATGGAGGG - Intergenic
1024771184 7:52725082-52725104 AGCGAGAGAAGAAATGAGGAAGG + Intergenic
1025014188 7:55425613-55425635 ATGGAGAGGACAAATGTCAATGG + Intronic
1025203794 7:56979780-56979802 AGGGTGAGAAAAAATGTGGAGGG - Intergenic
1025668147 7:63597150-63597172 AGGGTGAGAAAAAATGTGGAGGG + Intergenic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1027303946 7:76872525-76872547 ATGCAGATGAGAGATGAGGAAGG + Intergenic
1027306430 7:76902598-76902620 TTGCAGAGGAGAAATGAGAATGG + Intergenic
1027335986 7:77151220-77151242 TTGGAGATGAGACCTGTGGAAGG - Intronic
1027977516 7:85178445-85178467 ATGGAGATGAGAAATGTGTTGGG + Intronic
1028150320 7:87364737-87364759 ATCAAGAGCAGAAAGGTGGAGGG + Intronic
1028237913 7:88383452-88383474 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1028808091 7:95052365-95052387 AGGGAATGGAGAAAAGTGGAAGG + Intronic
1029020914 7:97364112-97364134 ATGCAGATGAGAAATGTCAATGG - Intergenic
1029128478 7:98312092-98312114 ATCGAGAGAAGCAATGTGGTAGG - Exonic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1030085982 7:105816095-105816117 ATGGGGAGGAGAAGTGAGGGTGG + Intronic
1030192359 7:106822293-106822315 TTGGGGAAGAGATATGTGGATGG + Intergenic
1030564879 7:111141305-111141327 ATTGGGAGGGGAAATGTGGAGGG - Intronic
1031092077 7:117370038-117370060 ATGGTGAGGAGACATGCGGGTGG + Intronic
1031538760 7:122967119-122967141 ATAGAGAGGAGAAAAGGAGAGGG - Intergenic
1031682123 7:124687980-124688002 TTGGGGAAGAGATATGTGGATGG + Intergenic
1032427015 7:131830514-131830536 ATGGAGAGGAGAGATGTTCGGGG + Intergenic
1032841188 7:135714645-135714667 ATGGCGAGGAGAGATGGGAAAGG + Intronic
1034738560 7:153452333-153452355 AGCTAGAGGAGAAAGGTGGAGGG + Intergenic
1034908398 7:154971464-154971486 ATGGAGAGGAGAAATCTGCAAGG + Intronic
1035120929 7:156566234-156566256 ATGGCCAGGTGAAAGGTGGAAGG - Intergenic
1035149989 7:156861825-156861847 ATGGAGAGGAGAAACTTGTTGGG - Intronic
1035333042 7:158108529-158108551 ATGGACAGGAAAGATGTGGAGGG - Intronic
1035500320 8:87238-87260 ATGGAGAGGAGAAAGGAGACGGG - Intergenic
1035500373 8:87431-87453 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
1035743593 8:1946177-1946199 ATGGAGGAAAGAAATGAGGAGGG + Intronic
1036161917 8:6397219-6397241 ATGGAGAGCTGAAATGTTCATGG + Intergenic
1036651603 8:10647485-10647507 GGGGAGAGGAGAAATGAGGATGG - Intronic
1037542881 8:19889261-19889283 ATGTGGAGTAGAAATGTGTAAGG + Intergenic
1037691772 8:21186671-21186693 GAGGAAGGGAGAAATGTGGAAGG + Intergenic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1038547685 8:28438379-28438401 AAGAAGAAGAGAAATGGGGACGG + Intronic
1038644698 8:29351876-29351898 ATGCAAAAGAGAAATGGGGATGG - Intergenic
1038702288 8:29859875-29859897 TGGGAGAGGAGAAAAGTGCAGGG - Intergenic
1038971552 8:32642141-32642163 ATGGAGAGGAGGAGTATAGAGGG + Intronic
1039093276 8:33855735-33855757 CTGGACAGGAGACATGTTGATGG - Intergenic
1039128133 8:34228076-34228098 TGGGAGAGGAGACATGTTGAAGG + Intergenic
1039324087 8:36465916-36465938 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1039365760 8:36926419-36926441 ATGGAGGGGAGAGATGTGGGTGG - Intronic
1039598527 8:38812752-38812774 ATGAAGGGGAAAAATGAGGATGG - Intronic
1039657355 8:39424079-39424101 ATGGAGATGAGAAATGTGTTGGG - Intergenic
1039778048 8:40756051-40756073 AAGGAGAGGATCAATGTGTATGG - Intronic
1040293470 8:46137249-46137271 TTGGAGAGGCCAAATTTGGAGGG + Intergenic
1040765305 8:50902679-50902701 AAGGAGAGGAGAAAGATGGCAGG + Intergenic
1040794136 8:51271221-51271243 AAGGAGAGGCGAGGTGTGGAGGG + Intergenic
1041151691 8:54942446-54942468 ATGGTGAGAAGAAACGTGGAGGG - Intergenic
1041568001 8:59302712-59302734 AAGGGGAGAAGAAATGGGGAAGG + Intergenic
1042328761 8:67556068-67556090 ATGCAGAACAGAGATGTGGATGG + Intronic
1042555816 8:70033116-70033138 AGGGAGAGGAGAAAGGAGGAAGG + Intergenic
1042622133 8:70718000-70718022 ATGGAGATGAGGAATTTGGAGGG - Intronic
1042728426 8:71903751-71903773 ATGGAGAGGAGGAATTTGTTGGG - Intronic
1042760415 8:72266446-72266468 ATGGAAAGGAGAACAGTGTAGGG + Intergenic
1042762217 8:72283247-72283269 CTGGAGAGGAGCACTGTGTAGGG - Intergenic
1044288290 8:90436874-90436896 ATTGAGAGGACAAAGGTAGAAGG + Intergenic
1044570738 8:93715487-93715509 ATGCATAGGAAAAATCTGGAAGG - Intronic
1044585357 8:93864583-93864605 ATGCATAGAAGAAATCTGGAAGG - Intronic
1044734686 8:95268060-95268082 ATGGAGAGAAGGAAGGTAGACGG + Intronic
1045875706 8:106978489-106978511 AAGGAGAGGAAAAAGATGGACGG + Intergenic
1046978503 8:120310999-120311021 ATGGAGAGGAGAACATTGCAAGG + Intronic
1047050879 8:121111692-121111714 AGGGTGAGAGGAAATGTGGAGGG + Intergenic
1047678016 8:127224074-127224096 AGGGAGAGTAGAAATGAGGCTGG - Intergenic
1047907179 8:129484699-129484721 AAGGAGAGGAGGAAGGTGGGAGG - Intergenic
1047994192 8:130317896-130317918 GTGGAGAGGAGAGCTGAGGAAGG + Intronic
1048080840 8:131124584-131124606 ATGGAGAGGACACGTGTGGATGG + Intergenic
1048135324 8:131741916-131741938 AGAGAGAGTAGAGATGTGGAGGG - Intergenic
1048761256 8:137798146-137798168 ATGGGGAGGAGATATGATGAAGG + Intergenic
1050132652 9:2428723-2428745 ATGGAGAGGAGAGAAGGGGAAGG + Intergenic
1050696063 9:8280739-8280761 AAAGAGAGGAGCAATCTGGATGG - Intergenic
1050741382 9:8824273-8824295 AGGGAGAGGGGAAATGTCAAAGG - Intronic
1050758933 9:9042284-9042306 ATCCTGAGGGGAAATGTGGATGG + Intronic
1052132551 9:24866496-24866518 ATAGAAATGAGAAATGTGAAAGG + Intergenic
1054720597 9:68599905-68599927 ATGAAGAGGAGAGAGGAGGATGG - Intergenic
1055815236 9:80197093-80197115 ATGGAGAGGATCTTTGTGGAGGG + Intergenic
1055841702 9:80512904-80512926 ATGGAGATGAGAATGGTGGTTGG - Intergenic
1057820914 9:98329826-98329848 GAGGAGAGGAGAGATGGGGAGGG - Intronic
1058524493 9:105843573-105843595 ATGGTGTGGAGAAATGTAGACGG + Intergenic
1059269549 9:113063262-113063284 GTAGAGAGGAGAAAGGTGGTTGG + Intergenic
1059270681 9:113068709-113068731 GTAGAGAGGAGAAAGGTGGTTGG + Intergenic
1059271816 9:113074156-113074178 GTAGAGAGGAGAAAGGTGGTTGG + Intergenic
1059272950 9:113079603-113079625 GTAGAGAGGAGAAAGGTGGTTGG + Intergenic
1059274085 9:113085045-113085067 GTAGAGAGGAGAAAGGTGGTTGG + Intergenic
1059275208 9:113090473-113090495 GTAGAGAGGAGAAAGGTGGTTGG + Intergenic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059909294 9:119024660-119024682 AGGGAGAGGAGAAAAGATGAGGG - Intergenic
1060207672 9:121691860-121691882 ATGGGCAGGAGAAATGTTTAGGG + Intronic
1060240371 9:121897877-121897899 AAGGAGAGGAGAAAAGAGAAGGG - Intronic
1060389443 9:123267010-123267032 TTGGGGAGGAGGAAGGTGGAGGG - Intronic
1060971266 9:127739575-127739597 GAGGAGTGGAGAAATGTGAATGG + Intronic
1061244763 9:129395799-129395821 ATGGATAGGAGAATGGTTGAAGG + Intergenic
1061942718 9:133891861-133891883 ATGGAGGGGAGGCATGGGGATGG + Intronic
1062182161 9:135196495-135196517 ATGGGAAGGAGAAATGGGAAGGG - Intergenic
1203387948 Un_KI270438v1:71988-72010 ATGGAGAGGAATAGAGTGGAAGG + Intergenic
1203718983 Un_KI270742v1:186057-186079 ATGGAGTGGAGTAGAGTGGAAGG - Intergenic
1203608534 Un_KI270748v1:75985-76007 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1203608569 Un_KI270748v1:76106-76128 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1203635507 Un_KI270750v1:106804-106826 ATGGAGAGGAGGAATTTGTTGGG - Intergenic
1185772216 X:2773400-2773422 AGGGAGAGGAGAAAGGTTGGAGG + Intronic
1186117927 X:6324733-6324755 AGGAAGAGGAAAAATCTGGAAGG - Intergenic
1186269304 X:7867478-7867500 TTGGAAAGGAGAATTGTGGGTGG - Intergenic
1186334136 X:8568415-8568437 ATGAAGATGAGAGACGTGGAAGG - Intronic
1186410652 X:9342411-9342433 ATGGGGAGGGGAGAGGTGGAGGG - Intergenic
1186925387 X:14328283-14328305 CTGGAGAGGGGAAATGTGCAAGG - Intergenic
1187253464 X:17620866-17620888 GTGGGGAGGGGAAAAGTGGAGGG + Intronic
1187505368 X:19874681-19874703 AGGGAGAGCAGAAGTGGGGAGGG + Intronic
1187524007 X:20037756-20037778 TTGGGGAAGAGATATGTGGATGG + Intronic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188714984 X:33449492-33449514 ATGGTGAGGAGATATGGGAATGG - Intergenic
1188909603 X:35830300-35830322 ATGGAGATGAACAATCTGGATGG - Intergenic
1189235102 X:39480877-39480899 GTGGAGAGGGGAGATGGGGAAGG + Intergenic
1189727846 X:43986439-43986461 GTGGAGTGGTGAAATGTGGTTGG + Intergenic
1189752234 X:44234072-44234094 CTGGTGAGGGAAAATGTGGAAGG - Intronic
1189768788 X:44400961-44400983 ATGGGAAGGAGTAATGTGTAAGG + Intergenic
1189841029 X:45078198-45078220 ATGGAAAGGAGAAATGTATGTGG + Intronic
1190774184 X:53539558-53539580 AGGGAGAGGAGTAACCTGGAAGG + Intronic
1190927470 X:54922247-54922269 ATGGATAGGAGAAATGACTACGG + Exonic
1190996666 X:55616856-55616878 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1192072325 X:67954063-67954085 GAGGAAAGGAGAAGTGTGGAAGG - Intergenic
1192177922 X:68897468-68897490 TTGGAGATGAGAACTCTGGAAGG + Intergenic
1192243871 X:69357624-69357646 AAAGAGAGGAGAAAGGGGGAAGG + Intergenic
1192330906 X:70174569-70174591 AAAGAAAGGAGAAAAGTGGAAGG - Intergenic
1193151122 X:78125492-78125514 ATGGAGTGGAGAAAGTTAGAAGG + Intronic
1193738801 X:85193228-85193250 ATGGGGAGGAAAAATGATGATGG + Intergenic
1193847127 X:86486542-86486564 CTGAAGAGGAGAATTGTGCATGG - Intronic
1194434991 X:93859331-93859353 ATGGAGATGAGAAATATCTAGGG + Intergenic
1194485198 X:94477952-94477974 GTGGAGAGGAGGTATATGGATGG + Intergenic
1195013469 X:100755574-100755596 ATGGGGAAGAGGTATGTGGATGG - Intergenic
1195494249 X:105511520-105511542 ATGGAGAGGACACATGTGGGTGG - Intronic
1195525997 X:105890220-105890242 ATGGAGATGAGAAATTTGTTGGG - Intronic
1195877177 X:109554002-109554024 ATGGAGAGCTGAAATGTTAATGG + Intergenic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196144981 X:112306630-112306652 ATGAAGAGGGGAAAGATGGAAGG + Intergenic
1196224469 X:113149218-113149240 AGGAAGATGAGAAATGTGGTGGG + Intergenic
1197164912 X:123366298-123366320 AGGGAGAGGAGAAATGTCAGAGG - Intronic
1197211203 X:123829689-123829711 ATGGAGGAGAGAAATTGGGATGG - Intergenic
1197301786 X:124789666-124789688 ATGGAGATGAGGAATTTGGTGGG - Intronic
1197591956 X:128420012-128420034 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1197687112 X:129452575-129452597 ATGCAGAGTGGAAATGTGAATGG + Intronic
1197775838 X:130118199-130118221 TTGGAGAGGAGAGATCAGGAGGG + Intergenic
1197850940 X:130859539-130859561 CTGGTGATGAGAAATGTAGAGGG + Intronic
1197951620 X:131903920-131903942 CTGGAGAGGTGAATTGTGAAAGG - Intergenic
1199295235 X:146149864-146149886 AAGGAGATGAGAAATGCAGAGGG - Intergenic
1199369504 X:147030604-147030626 AAACAGAGGAGAAATCTGGATGG - Intergenic
1199541851 X:148966448-148966470 ATAGAGAGGAGAGAGGAGGAGGG - Intronic
1199544537 X:148994028-148994050 AGGGATATGAGACATGTGGATGG + Exonic
1199712044 X:150476565-150476587 ATGGGGAGGAGGGATGTGGATGG + Intronic
1199914262 X:152321886-152321908 ATGGAGAGGAGAGGAGTGGCGGG - Intronic
1200780003 Y:7206130-7206152 ATGGAGAGCAGAAATGTACGAGG - Intergenic
1200823003 Y:7607078-7607100 ATGGAGAGGAGAAACTTGTTGGG - Intergenic
1201121958 Y:10880113-10880135 GTGGAGTGGAGTAAAGTGGAAGG - Intergenic
1201132021 Y:10959665-10959687 ATGGAGTGGAGTAGAGTGGAAGG - Intergenic
1201173151 Y:11290949-11290971 ATGGAGTGGAGTAGAGTGGAAGG - Intergenic
1201450972 Y:14115047-14115069 TTGGAAAGGAGAATTGTGGGTGG + Intergenic
1201914655 Y:19169287-19169309 ATGGTGAGGCAAAATGTTGATGG - Intergenic
1202237052 Y:22724017-22724039 ATGGAGAGGAGAAACTTGTTGGG + Intergenic