ID: 1107483081

View in Genome Browser
Species Human (GRCh38)
Location 13:40801417-40801439
Sequence TTCTCACAGGATCACGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107483081_1107483088 10 Left 1107483081 13:40801417-40801439 CCCTCACCGTGATCCTGTGAGAA 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1107483088 13:40801450-40801472 GATGTTACCTCTCTTAGGGATGG 0: 1
1: 0
2: 0
3: 9
4: 107
1107483081_1107483087 6 Left 1107483081 13:40801417-40801439 CCCTCACCGTGATCCTGTGAGAA 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1107483087 13:40801446-40801468 GGCAGATGTTACCTCTCTTAGGG 0: 1
1: 1
2: 0
3: 7
4: 99
1107483081_1107483086 5 Left 1107483081 13:40801417-40801439 CCCTCACCGTGATCCTGTGAGAA 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1107483086 13:40801445-40801467 AGGCAGATGTTACCTCTCTTAGG 0: 1
1: 1
2: 0
3: 31
4: 203
1107483081_1107483090 20 Left 1107483081 13:40801417-40801439 CCCTCACCGTGATCCTGTGAGAA 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1107483090 13:40801460-40801482 CTCTTAGGGATGGAAAACTGAGG 0: 1
1: 0
2: 3
3: 28
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107483081 Original CRISPR TTCTCACAGGATCACGGTGA GGG (reversed) Intronic
902713815 1:18258756-18258778 TTCTCACAAGATCACATGGAAGG - Intronic
903885371 1:26537855-26537877 GTCTCACAGGAGCAATGTGAAGG + Intronic
907109665 1:51915356-51915378 TTCTGAGAGTATCACAGTGATGG - Exonic
909437742 1:75663201-75663223 TTCTCACACCATCACATTGAGGG - Intergenic
912845800 1:113073630-113073652 TACTCACAGGATAGCGGTGTCGG - Exonic
918052360 1:180985383-180985405 TTCTCACAAGAGCCCTGTGAGGG - Intronic
923578360 1:235182982-235183004 TTCTATTACGATCACGGTGATGG + Intronic
924945940 1:248847043-248847065 TCCCCACAGGCTCACGGTGCAGG + Exonic
1064787349 10:18912940-18912962 TTCTCACAAGATAATTGTGAGGG - Intergenic
1069875647 10:71561408-71561430 TGCTCACTGGAACAGGGTGAGGG - Intronic
1070251096 10:74773613-74773635 ATTTCACAGCATCACAGTGATGG - Intergenic
1076134551 10:128036425-128036447 TGCTCATAGGATTTCGGTGAGGG + Intronic
1076535100 10:131172178-131172200 TTCTTACAGCCTCATGGTGAGGG - Intronic
1077039331 11:511754-511776 TTCTCACAGCATCTCCGTGCAGG - Intergenic
1077325853 11:1963702-1963724 TTCCCACAGGTTCACTGGGAGGG + Intronic
1080261639 11:30355497-30355519 TTCTCACATGTTCACCCTGAGGG - Intergenic
1083753068 11:64773050-64773072 TTCTCACAGGTACACAGTGCAGG - Intronic
1084805433 11:71575696-71575718 TTCTCACAGGATCAGAGACAGGG - Intergenic
1085772687 11:79339174-79339196 TTCTCACTGGATCACGGAATGGG - Intronic
1085773312 11:79343483-79343505 TGCTCACAAGAACACTGTGAAGG - Intronic
1087052059 11:93896250-93896272 CTCTTCCAGGATCACGGGGAGGG - Intergenic
1089924390 11:122242356-122242378 TTCTCACAGGACCGAGGAGAGGG - Intergenic
1202808833 11_KI270721v1_random:18881-18903 TTCCCACAGGTTCACTGGGAGGG + Intergenic
1091877079 12:3944236-3944258 TTCACTCAGCATCACGGTGCTGG - Intergenic
1091976792 12:4831938-4831960 GTCTCACAGAAACATGGTGAGGG + Intronic
1099054941 12:77827766-77827788 TTCTCACAGCACCCCTGTGAAGG + Intergenic
1100012560 12:89971223-89971245 TTCTCTCTGGAGCACTGTGAAGG - Intergenic
1101213587 12:102559411-102559433 GTATTACAGGATCAAGGTGAGGG - Intergenic
1102006120 12:109590306-109590328 TTCTCACTGGATGACTGTGCCGG + Intronic
1103566102 12:121816577-121816599 TTCTCACAGCATCCCTTTGAAGG + Intronic
1104842859 12:131832889-131832911 TGCTCACATGCTCACGGTGGTGG - Intronic
1107483081 13:40801417-40801439 TTCTCACAGGATCACGGTGAGGG - Intronic
1109119829 13:58440718-58440740 TTGTCACAGGATCAAGAGGAGGG - Intergenic
1111947571 13:94681805-94681827 TTCTCAGGGGATGACGGTGCCGG + Intergenic
1112128659 13:96497610-96497632 TTTTCAAAGGATCACTTTGAGGG - Intronic
1118032918 14:61835987-61836009 TTCTAACAAGTTCCCGGTGATGG - Intergenic
1118821153 14:69347031-69347053 TTCTCTCAGGGTCCCCGTGAAGG + Exonic
1119263193 14:73250293-73250315 TTCTCCAAGGATGAAGGTGAGGG - Intronic
1119432392 14:74576933-74576955 TTCTCACAACATCCCAGTGAGGG + Intronic
1119520683 14:75282618-75282640 TTCTCACAAAATCACGTGGAGGG + Intergenic
1129161167 15:73748726-73748748 ATCTCACAGGAAGACGGTGATGG + Intronic
1129880289 15:79002103-79002125 TTCTAACAGGTTCCAGGTGATGG + Intronic
1130184047 15:81662034-81662056 TTCTCACAGAAACAAGGAGAAGG - Intergenic
1130188345 15:81707904-81707926 TTCTCACAGAAACAAGGAGAAGG - Intergenic
1130343089 15:83015715-83015737 TTCTCACAGCATCAGTATGAGGG - Intergenic
1132344420 15:101099703-101099725 ATCTCACAGGACTACTGTGAAGG + Intergenic
1134297221 16:12957606-12957628 TTCTAATAGGATCACATTGAGGG + Intronic
1138435521 16:56997407-56997429 ACTTCACAGGATCACTGTGAGGG - Intronic
1141446204 16:84060264-84060286 TTTTCACAGGATTACTGAGAGGG + Intronic
1144253744 17:13445039-13445061 TTCTCATATGATCTAGGTGATGG - Intergenic
1145035220 17:19535916-19535938 TTCTCACAGCAGCTCTGTGAGGG - Intronic
1149670288 17:58402193-58402215 TGCTCAAAGGATCCCTGTGAGGG + Intronic
1150140900 17:62727799-62727821 TTCTCACAGAAGCATGGAGAAGG + Intronic
1150487006 17:65550899-65550921 TTATCACAGGCTCACGAGGAGGG + Intronic
1156165637 18:34417051-34417073 ATCTCACAGGATAAAGTTGAAGG - Intergenic
1157157036 18:45278534-45278556 ATATCACAGGATCACTGTGATGG + Intronic
1158611590 18:58945312-58945334 TTCTCAAAGGATCACTCTGGGGG + Intronic
1159037371 18:63290579-63290601 GTCACACAGGATTACTGTGATGG - Intronic
1160258811 18:77271623-77271645 TTCTCCCAGCATCAGGTTGAGGG + Exonic
1162189040 19:8930288-8930310 CTCTTACAGGATCAAGGTGGAGG + Intronic
1163056712 19:14725519-14725541 ATTTCACAGGCTCACGGGGAAGG - Intronic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1168164161 19:54535225-54535247 ATCTCACAGGCTCACACTGAAGG - Intronic
929537249 2:42791611-42791633 TTCTCACAGTAGCACCGTGAGGG - Intronic
930257827 2:49111912-49111934 TTCTCACAAAATCTTGGTGAAGG + Intronic
930799060 2:55423451-55423473 TTCTAAAACGATCATGGTGATGG + Intergenic
936924261 2:117720650-117720672 TTCTAACAGCATCACGAGGAGGG + Intergenic
938220794 2:129565653-129565675 TTCCCACAGGCTCATGGTGCTGG - Intergenic
940817801 2:158315673-158315695 GACTCACAGCATCTCGGTGATGG - Intronic
941582261 2:167313738-167313760 ATCTGTCAGGATCACAGTGATGG - Intergenic
941963535 2:171277447-171277469 TTCTCACAGGCCCACGGTGGAGG - Intergenic
943083040 2:183279640-183279662 TCAACACAGGATCACGATGAAGG - Intergenic
945988983 2:216377664-216377686 TTCTCACTTGTTCACTGTGATGG + Intergenic
946701642 2:222420844-222420866 TTCTCACAGGGTCACAGTCAAGG - Intergenic
946707402 2:222472082-222472104 TTCTCACACCATCATTGTGATGG + Intronic
948022040 2:234741925-234741947 TATTCCCAGGATGACGGTGAAGG + Intergenic
1168987142 20:2059288-2059310 TTCTCAAAGGTTCACACTGAAGG + Intergenic
1171396218 20:24835450-24835472 GTCTCACTGGATCATGGTGAAGG - Intergenic
1173034076 20:39391599-39391621 TTCTAACAGCATCACGTTGGGGG + Intergenic
1175494729 20:59405691-59405713 CCCTCACAGGAGCACGGAGAGGG - Intergenic
1176660764 21:9633515-9633537 TTCTCCTAGGATCAGGGAGAAGG - Intergenic
949474032 3:4425634-4425656 TTCTCACATCATGACTGTGATGG - Intronic
951746672 3:25985928-25985950 TTCTCACAGAATCAGTGGGAAGG + Intergenic
954423585 3:50431593-50431615 TTCTCACAGCAACCCGGAGAAGG - Intronic
956353651 3:68366328-68366350 TTGTCACAGGATGAGTGTGAAGG + Intronic
956422778 3:69101850-69101872 TCCTCCCAGGATCATGTTGAAGG - Exonic
956769123 3:72509598-72509620 CTCTCAGTGGATCAAGGTGATGG + Intergenic
964005253 3:151819140-151819162 TTCTGACAGGATGACTGGGAGGG + Intronic
964553035 3:157906185-157906207 ATCTCTCAGGATCAGGGTTAAGG + Intergenic
965721788 3:171669800-171669822 GTCTCACAGGATTGTGGTGATGG - Intronic
967138427 3:186532257-186532279 TTCTCACATAATCATGGTGAGGG + Intergenic
968094264 3:195916948-195916970 TTCTTACAGTCTCCCGGTGAGGG - Intergenic
969140981 4:5071386-5071408 TTTCCACAGGATCAAGGAGATGG - Intronic
969856271 4:10002218-10002240 TGCTCACAGGATCAGTGGGAGGG - Intronic
969964034 4:10975776-10975798 TTCTCACAGCAACACTGTGAGGG - Intergenic
970401570 4:15722239-15722261 TTCTCACAGTAGCAAGTTGAAGG - Intronic
972976661 4:44644003-44644025 TTCTCACAGCTGCACTGTGAGGG - Intronic
974446383 4:61988466-61988488 TTCTGACAGTATCACATTGATGG - Intronic
978092443 4:104734545-104734567 TTTTCACAGCATCTCTGTGAGGG - Intergenic
981286992 4:143028950-143028972 TACTCACAGGATCAAAGTAAAGG + Intergenic
984975759 4:185228834-185228856 TTCTCATAGGATAACTGTGAAGG - Intronic
985414599 4:189722901-189722923 TTCTCCTAGGATCAGGGAGAAGG + Intergenic
991080791 5:62596803-62596825 TTCTTACAGGATCAAGTTAATGG + Intronic
993755415 5:91723205-91723227 TTCACACAGGATTATGGTAAAGG + Intergenic
997528062 5:134566224-134566246 TTCTGCCAGGAGCACAGTGACGG + Exonic
998294000 5:140947915-140947937 TTCTCATAAGATCAGGGTTAAGG - Intronic
1001329644 5:170753090-170753112 CTCACACAAGATCATGGTGATGG + Intergenic
1006807991 6:36800989-36801011 CTCTCACAAGGTCACAGTGAAGG - Intronic
1007924552 6:45640896-45640918 TTCTCCCAGGAGCAAGGTGGAGG + Intronic
1013137417 6:107295915-107295937 TTCCCACAGGATGATGGTGGTGG - Intronic
1013792051 6:113848435-113848457 TTCTCACAGTGGCACTGTGAAGG + Intergenic
1016357824 6:143236944-143236966 TTCTCACAGAAACCCAGTGAAGG + Intronic
1020053573 7:5100694-5100716 ATCTCACTTGATCACAGTGAAGG + Intergenic
1023337057 7:39181237-39181259 TTCTCAAAGGACCACAGTGGAGG - Intronic
1023535374 7:41203261-41203283 TTCTTACAGGGTTACTGTGAGGG - Intergenic
1023656104 7:42422452-42422474 ACCTCACAGGATTACTGTGAAGG - Intergenic
1023694339 7:42829340-42829362 GTCTTACAGCATCACTGTGAAGG - Intergenic
1026142074 7:67714778-67714800 TTCTCACAGAAACCTGGTGATGG - Intergenic
1030845145 7:114400507-114400529 TTCATTCAGGATCACTGTGATGG + Intronic
1034131034 7:148717682-148717704 TGATCACAGGAGCCCGGTGAAGG - Intronic
1034742685 7:153493548-153493570 TTCTCTCAGCATAACTGTGATGG + Intergenic
1036235178 8:7033806-7033828 TTTTCTCAGCATCAAGGTGAAGG + Intergenic
1037697196 8:21234015-21234037 TTCTCATAGGGTTACAGTGATGG - Intergenic
1038693950 8:29788454-29788476 TTCTCAGAGGATCACTTAGAGGG - Intergenic
1042209544 8:66366183-66366205 TTCTCACAGGATTCTGGTGAAGG - Intergenic
1044741288 8:95329245-95329267 TTTTACCAGGATCAGGGTGAAGG - Intergenic
1049354258 8:142179848-142179870 TTCTCACAGGAGCAGGGCCAAGG - Intergenic
1052363046 9:27580480-27580502 TTCTCCTAGGATCATTGTGAGGG + Intergenic
1055066933 9:72128691-72128713 GTCTCACAGGACTACTGTGATGG - Intronic
1055499660 9:76890206-76890228 GTCTCAGAGGATGACGGTGAAGG + Intronic
1056713343 9:89009207-89009229 TCCACACAGGATCACAGGGAAGG - Intergenic
1058628391 9:106959710-106959732 TTCTCATAAGGTCATGGTGAAGG + Intronic
1061847725 9:133397250-133397272 TTCTAACAGCATGTCGGTGATGG - Exonic
1203638332 Un_KI270750v1:135359-135381 TTCTCCTAGGATCAGGGAGAAGG - Intergenic
1186432234 X:9514683-9514705 TTCTCACAGGATCATAGAGCAGG + Intronic
1187494302 X:19781252-19781274 TTCTAACAGGCTCCAGGTGATGG + Intronic