ID: 1107483595

View in Genome Browser
Species Human (GRCh38)
Location 13:40805433-40805455
Sequence CTTTTTATGCAGTGGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107483595_1107483601 19 Left 1107483595 13:40805433-40805455 CCCACCACCCACTGCATAAAAAG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1107483601 13:40805475-40805497 ACCCCAGAACTGGAGAAGCCAGG 0: 1
1: 0
2: 10
3: 46
4: 337
1107483595_1107483600 9 Left 1107483595 13:40805433-40805455 CCCACCACCCACTGCATAAAAAG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1107483600 13:40805465-40805487 GATATTTAATACCCCAGAACTGG 0: 1
1: 0
2: 0
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107483595 Original CRISPR CTTTTTATGCAGTGGGTGGT GGG (reversed) Intronic
904027059 1:27510807-27510829 ATTTTTGTGCAGTGTGAGGTAGG + Intergenic
904907366 1:33907798-33907820 CTCTTTATCCAGTGGCTGATGGG - Intronic
905761730 1:40564074-40564096 GTTTTTTTTCAGGGGGTGGTGGG - Intergenic
909252010 1:73370446-73370468 CTCTATATTGAGTGGGTGGTGGG - Intergenic
909266470 1:73565024-73565046 CTTTTTATTGTGTGGGTGGTGGG - Intergenic
910421915 1:87074345-87074367 GTTTTTATACAGTGTGTAGTAGG + Intronic
910751613 1:90637284-90637306 CTTTTAATGCAGTCTGTGATTGG + Intergenic
912634439 1:111278803-111278825 CCTTTAATGGAGTGGGAGGTGGG + Intergenic
914815991 1:151062858-151062880 AGATTTAAGCAGTGGGTGGTTGG + Intronic
915426674 1:155833338-155833360 CTTTTTTTGCAGTGGGAGAATGG - Intronic
915534350 1:156526041-156526063 CTGCTGATGCAGTGGGAGGTAGG + Exonic
917677879 1:177337642-177337664 CATCTGATGCAGTGGGTTGTGGG - Intergenic
919847970 1:201653599-201653621 CTTTTTATTCAGTGCATTGTGGG + Intronic
922352993 1:224750114-224750136 CTTTGTATGTGGTAGGTGGTAGG + Intergenic
923566860 1:235082942-235082964 TTTTTTTTGCAGTGGGGGGTGGG - Intergenic
1065841022 10:29701149-29701171 CTATTTTTGCAGTGAGGGGTGGG - Intronic
1066121211 10:32289411-32289433 CTTTTTTTGCAGGGGGAGGCGGG - Intronic
1069825302 10:71251367-71251389 CTTTTGATATAGTAGGTGGTAGG + Intronic
1070870395 10:79746287-79746309 GTTTTTTTGCAGTGGGGGGCTGG + Intergenic
1071365536 10:84896681-84896703 CTTTTTTTGCGATGGGTTGTGGG + Intergenic
1071637314 10:87268507-87268529 GTTTTTTTGCAGTGGGGGGCTGG + Intergenic
1071657932 10:87469447-87469469 GTTTTTTTGCAGTGGGGGGCTGG - Intergenic
1074706951 10:116141576-116141598 CTTTTTTTTGAGGGGGTGGTGGG + Intronic
1077206738 11:1348429-1348451 CTGCTTAAGCAGTGGGTGGCTGG - Intergenic
1078148938 11:8742330-8742352 TTTTTTTTGAGGTGGGTGGTTGG + Intronic
1078615496 11:12861648-12861670 GTTTGTATGCTGTGGGTGGTGGG - Intronic
1079815547 11:25052360-25052382 ATTTTTCTGCAATGGGTTGTGGG - Intronic
1079960747 11:26920236-26920258 CTTTTGATGGAGGGTGTGGTGGG - Intergenic
1080269034 11:30431143-30431165 CTTTTTTTGCAGCGGGTTGGGGG + Intronic
1080679747 11:34463160-34463182 CTGTTTAGGCAGTGTGTGCTCGG + Intronic
1080684327 11:34502778-34502800 CTGTTTTCTCAGTGGGTGGTGGG + Intronic
1083055825 11:59818742-59818764 CAGTTTATGCAGCAGGTGGTAGG + Intergenic
1083894725 11:65614132-65614154 CTTTTTGCGCAGGGGGTGGAGGG + Exonic
1088451384 11:109984792-109984814 CTCCTTATTCAGTGGGTTGTGGG - Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089911539 11:122105604-122105626 CATTTGCTGCAGTGGGAGGTGGG - Intergenic
1090172691 11:124618638-124618660 CTTTTTTTGGAGTGGGGGGGTGG + Intronic
1091561081 12:1614047-1614069 CTCTTTGTGCAGTGGATGCTGGG + Intronic
1091883955 12:4002695-4002717 CTTTATTTGCTGTGTGTGGTGGG - Intergenic
1095082446 12:38021264-38021286 CTTTTTGTGGATTGGGTAGTGGG + Intergenic
1096612662 12:52813415-52813437 CTTTTTGTCCCGTGGCTGGTGGG - Intronic
1098710255 12:73749178-73749200 CTTTTTATCAACTGGGTGCTTGG + Intergenic
1098769108 12:74530339-74530361 CTTTTTGTGGAATGGATGGTTGG + Intergenic
1103605542 12:122083302-122083324 CTGTTTAAGAAGTGGGTGTTTGG + Intronic
1104221624 12:126790102-126790124 CTGTTTCTGCATTGTGTGGTGGG + Intergenic
1104808883 12:131608031-131608053 CTTTGCATGCAGTGGCTGGTCGG + Intergenic
1105830232 13:24157607-24157629 CTTTTTCTGCAGTAGAGGGTGGG + Intronic
1107483595 13:40805433-40805455 CTTTTTATGCAGTGGGTGGTGGG - Intronic
1110019795 13:70456089-70456111 CTTTTTAGACAGTGCCTGGTGGG - Intergenic
1112695718 13:101945706-101945728 CTGCTAATGCAGTGGGAGGTAGG - Intronic
1115325755 14:32136032-32136054 CTTTTAATTCAGTGGGAGCTAGG + Intronic
1115525582 14:34277258-34277280 CTTTTTAGGGAGTGGGAGGCAGG - Intronic
1115618571 14:35119654-35119676 CTTTTTAAAAGGTGGGTGGTCGG - Intronic
1118274556 14:64373854-64373876 TTTTTTTTGCAGTGGGGGGTGGG + Intergenic
1119637858 14:76291372-76291394 TTTTTTTTGCAAGGGGTGGTGGG - Intergenic
1125816420 15:42588808-42588830 TTTTTTTTGGAGTGGGGGGTGGG + Intronic
1125835166 15:42743532-42743554 CTTTTTTTGCAGGGGGTCGGGGG - Exonic
1126519632 15:49577295-49577317 CTTTTTTTGCAGGGGGTGTGGGG - Intronic
1126910040 15:53408215-53408237 CTTTTAGTGCAGTGGGTGAATGG - Intergenic
1127288998 15:57553937-57553959 CTTTTGGCGCAGTGTGTGGTGGG + Intergenic
1127423703 15:58834497-58834519 CATTTAATGGAGTTGGTGGTAGG - Intronic
1130022135 15:80240515-80240537 CTTTTTATTTGTTGGGTGGTGGG - Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1132258321 15:100398110-100398132 CTTTTTTTGTGGCGGGTGGTGGG + Intergenic
1132296783 15:100742040-100742062 CTTTTTCTGCATTGATTGGTAGG + Intergenic
1132992522 16:2804227-2804249 CTTTTGATGCACTGGGTGCTGGG + Intergenic
1133141705 16:3749546-3749568 CTCCTTATGGAGTGGGTTGTGGG - Intronic
1133252895 16:4495892-4495914 CTTTTCAGGCACTGAGTGGTGGG + Intronic
1134345741 16:13389742-13389764 CTCTTAATGCAGTGGGTTTTGGG - Intergenic
1134346015 16:13392646-13392668 CTCTTAACGCAGTGGGTGTTGGG - Intergenic
1135109820 16:19681894-19681916 CTTATTTTTCTGTGGGTGGTGGG - Intronic
1135832291 16:25786238-25786260 CTTTATAGGCAGTGAATGGTTGG + Intronic
1136054845 16:27680686-27680708 CTTTTTTTGCAGAGGGAGGGTGG + Intronic
1136559874 16:31033089-31033111 CTTTCGAGGCAGTGGGTGGTAGG - Intronic
1137806450 16:51310784-51310806 TTTTTTTTGCAGTGGGGGGAGGG - Intergenic
1138115408 16:54356906-54356928 CTTTTCATCCAATGCGTGGTTGG + Intergenic
1138675523 16:58648523-58648545 CTTTTTCTGTAGTGGGAGGGTGG + Intergenic
1138724236 16:59118502-59118524 CCTTGTCTGCAGTGGGTGGGTGG + Intergenic
1138837635 16:60457865-60457887 CTTGATATGCAGTGACTGGTTGG + Intergenic
1139075123 16:63436776-63436798 CTTTTGGTGCATTGGGAGGTGGG + Intergenic
1140712939 16:77695121-77695143 CTTTTTAGGGGGTGGGTGGGCGG + Intergenic
1141114807 16:81299435-81299457 CTTTGTATGCAGTGTGAGGCAGG + Intergenic
1145325072 17:21816074-21816096 CTGTTCTTGGAGTGGGTGGTTGG + Intergenic
1146408352 17:32559950-32559972 CTTTTTATGCAGTTGGATGAGGG - Intronic
1147660409 17:42114146-42114168 CTCTTGATGCAGTGTGGGGTGGG - Intronic
1148006001 17:44430080-44430102 AGTTTTATGTAGTGGGTGGGTGG - Intronic
1148396217 17:47310140-47310162 CTCTTTATACAGTGGGTTGTTGG - Intronic
1148737674 17:49874018-49874040 CTTTTTATGGAGATGGAGGTGGG - Intergenic
1149709366 17:58725984-58726006 TTTTTTTTGCAGGGGGTGGATGG - Intronic
1149737743 17:59012257-59012279 CTTTTTTGGTGGTGGGTGGTGGG - Intronic
1151212146 17:72552695-72552717 GTTTTTATGCAGCTGGTGGGAGG - Intergenic
1153778915 18:8477296-8477318 CTATTTGTGCAGTTGGTAGTGGG + Intergenic
1157086702 18:44587467-44587489 CTTTTTCTGCAGTGGCTGCCAGG + Intergenic
1160145245 18:76358516-76358538 CTTTGTTTGCCGTGGTTGGTGGG - Exonic
1161587283 19:5112525-5112547 CTGTTTCTGCAGAGCGTGGTGGG - Intronic
1162224319 19:9207309-9207331 TTTTTTATGAAGTGTGGGGTAGG + Intergenic
1162349789 19:10141902-10141924 TTTTGTAAGAAGTGGGTGGTTGG - Intronic
1163362676 19:16857658-16857680 CTATTTTTGATGTGGGTGGTGGG - Intronic
1163362977 19:16859690-16859712 CTGTTTGTGACGTGGGTGGTGGG + Intronic
1163722603 19:18905353-18905375 CTCTCTATGCAGTGGGTGGCAGG - Intronic
1166668706 19:44697324-44697346 CTGTTTGTGCAGTGGGTGGGGGG - Intergenic
1167777743 19:51571979-51572001 CTTTCTAGGCAGTGAGTGTTGGG + Intronic
926010540 2:9402671-9402693 CTTTTTGTGGAGTGGGTGGGGGG - Intronic
928255045 2:29714922-29714944 CTTGTTCTGCAGTGGGTCTTGGG + Intronic
928338985 2:30425127-30425149 CATTACATGCAGTGGGTGCTGGG + Intergenic
928653066 2:33422262-33422284 TCTTAGATGCAGTGGGTGGTTGG - Intergenic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
933289354 2:80420634-80420656 CTTTTCCTGGAGTGGGTGATGGG + Intronic
935815744 2:106844226-106844248 CTTGTTTTGCAGAGGTTGGTGGG - Intronic
939326286 2:140693699-140693721 CTTTTTTTGGGGTGGGTGGCGGG + Intronic
940067550 2:149646927-149646949 CTTAGCATGCACTGGGTGGTTGG - Intergenic
940489496 2:154339842-154339864 CTTATTTTGCAGTGAGTGGCTGG + Intronic
941605029 2:167586044-167586066 CATTTTTTGGAGTGGCTGGTAGG + Intergenic
945161270 2:206893855-206893877 CTTTGTATACAGTGAGTGATAGG + Intergenic
945867697 2:215194906-215194928 ATATGTATGCAGTGGCTGGTTGG + Intergenic
1169575590 20:6956632-6956654 CTTTTCCTTCAGTGCGTGGTGGG + Intergenic
1176695668 21:9974372-9974394 CTTATTATGTAGTGGGTACTTGG - Intergenic
1179172270 21:38981697-38981719 CTTGTTAGGGAGTGGGTGCTGGG - Intergenic
1181368261 22:22396857-22396879 CTTTTTGAGGAGCGGGTGGTTGG - Intergenic
1181913892 22:26263659-26263681 CCTTTTATGCAGTGGCCTGTAGG + Intronic
1182442631 22:30373184-30373206 CTTTCCATTCAGTGGGTGTTAGG + Intronic
1182470849 22:30547311-30547333 CTGCTTGTCCAGTGGGTGGTGGG - Intergenic
950681111 3:14585716-14585738 CCTGGTATGCAGTGGGTGCTTGG - Intergenic
950730271 3:14950164-14950186 ATTTTTATGCAGTGTGGTGTAGG + Intronic
954421812 3:50422853-50422875 CTACTTATGAAGTGGGTGGGGGG + Intronic
955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG + Intronic
957283071 3:78179017-78179039 CATTTTTTGGATTGGGTGGTGGG - Intergenic
957309566 3:78502275-78502297 CATTTAATGAAGTGGGTGGCAGG - Intergenic
957977844 3:87470227-87470249 GTTCTTGTGCAGTGGGTGGGAGG - Intergenic
958628643 3:96658898-96658920 CTTATTAAGCATTGGGTGGAGGG + Intergenic
960463025 3:117960160-117960182 GTTTTTGGGAAGTGGGTGGTGGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
962616925 3:137135590-137135612 TTTTTGATGCAGGGGGTGGATGG - Intergenic
963527957 3:146437925-146437947 CATTTAATGCAGTGGGTAGAGGG - Intronic
966366200 3:179190313-179190335 TCTTTTATGCTGGGGGTGGTGGG - Intronic
968736824 4:2301663-2301685 CTTTTGCTGCTGGGGGTGGTGGG - Intronic
971232997 4:24815830-24815852 CTTTTTAAGCAGTGGGTGCAGGG + Intronic
972442568 4:39109644-39109666 TTTTTTTTGGAGGGGGTGGTGGG + Intronic
977913897 4:102568810-102568832 CTTGTAGTGCAGTGGGTTGTGGG + Intronic
978008679 4:103651788-103651810 CTTTTTAGTCAGTCGGTGATGGG + Intronic
978927466 4:114265662-114265684 TTTTTAATGCACTGAGTGGTTGG - Intergenic
979296539 4:119038990-119039012 CTTTTTTTGAAGTTGGTGATGGG - Intronic
981843637 4:149141262-149141284 CTTTGTATACTGTGGGTGTTTGG + Intergenic
982140369 4:152311605-152311627 TTTTTTTTGCAGAGGGTGTTGGG + Intergenic
982712968 4:158776743-158776765 CTTTTAATGCAGTGCTTGGCAGG + Intronic
983121981 4:163897690-163897712 CTTTTTATGCGGTGAGAGATGGG - Intronic
983488647 4:168362001-168362023 CCTTTTCCCCAGTGGGTGGTGGG - Intronic
985018898 4:185666344-185666366 CTTTTTCTGCACTGTGTGGTTGG - Intronic
988239191 5:28587315-28587337 GTTTTTTTGTAGTGGGAGGTGGG + Intergenic
989429759 5:41339048-41339070 CTTCTTCTGCAGTGAGTGGCAGG + Intronic
991975996 5:72184088-72184110 GTATTTATGCTGGGGGTGGTGGG + Intronic
992168240 5:74076174-74076196 CTTTTAATGCAGGAGGTGGGGGG - Intergenic
992302994 5:75404275-75404297 TTTTTTATGAAGTAGGTTGTAGG - Intronic
994502181 5:100593083-100593105 CTTTTTAAGCACTGGGTGCCTGG + Intergenic
995037676 5:107553392-107553414 CTTTGAAAGCAGTGGATGGTGGG - Intronic
995184139 5:109254073-109254095 CTTCTACAGCAGTGGGTGGTGGG + Intergenic
995723407 5:115161376-115161398 GTGTTTCTGCTGTGGGTGGTAGG - Intronic
998272258 5:140717568-140717590 GTTTATATGCAGTGCGTGGAAGG + Intergenic
998474964 5:142412814-142412836 GTTTTTCTGAAGTGGGTGGTAGG - Intergenic
998690653 5:144584042-144584064 CTTGTTATGGGGTGGGTGGGGGG - Intergenic
1001903279 5:175448925-175448947 CAGTTTCTGCAGTGGTTGGTGGG + Intergenic
1003721114 6:8702982-8703004 ATTTTTATACAGTGGGTTATGGG + Intergenic
1004911013 6:20283996-20284018 ATTTTTGTGTAGTGAGTGGTAGG - Intergenic
1007661919 6:43492055-43492077 CTTTTTTTGCAGGGAGGGGTTGG + Intronic
1008884915 6:56422487-56422509 TTTTTTATCCACTGGTTGGTTGG - Intergenic
1015606510 6:134961599-134961621 ATTTTTATGTTGTGGGTGGGAGG - Exonic
1018244285 6:161806919-161806941 GTTTTTATGCAGGTGGTGTTCGG - Intronic
1018656564 6:166042644-166042666 CTTTTTTGGGAGTGGCTGGTGGG - Intergenic
1019101148 6:169631402-169631424 CTATTAATGAACTGGGTGGTGGG + Intronic
1022039981 7:26571889-26571911 TATTTTATTGAGTGGGTGGTAGG + Intergenic
1022437016 7:30397019-30397041 TTTTTTATACAGAGGGTGGGGGG - Intronic
1023873832 7:44276431-44276453 CCCTTTGTGCAGTGGGTGGCGGG - Intronic
1024926647 7:54622767-54622789 CCTCTTATGCAATGGGAGGTGGG - Intergenic
1025227476 7:57177878-57177900 CTTTGTCTGCAGTGGGTGAATGG - Intergenic
1026105328 7:67416523-67416545 CTCTTTGTGCAGTGGGAGGCTGG + Intergenic
1026651966 7:72223508-72223530 CTTTTTAAGCAGTGGCTGCTGGG - Intronic
1027427794 7:78079608-78079630 CTTTGTAAACAGTGGTTGGTTGG + Intronic
1033010604 7:137618468-137618490 CTTGTTATGAAGTGGGGGGGAGG - Intronic
1035341365 7:158164702-158164724 CTTTTTAAGCTGTGGGAGATGGG + Intronic
1038211166 8:25520379-25520401 CTTTTAGTGCAGTGAGTAGTAGG - Intergenic
1039490212 8:37941900-37941922 TTTTTTGTGGAGTGGGTGGGGGG - Intergenic
1043200263 8:77360652-77360674 CTTTATATGCATTGAGTGATTGG - Intergenic
1043480437 8:80647311-80647333 CTTTTTCTGCAGTGCCTTGTAGG - Intronic
1045299202 8:100896258-100896280 CTTTTGATGCATTGGTTGGATGG + Intergenic
1048955990 8:139536415-139536437 TTTTTCATGCTGTGGGTGGCAGG + Intergenic
1049271234 8:141697336-141697358 CTTTTCAGGCACTGGGAGGTTGG + Intergenic
1049860752 8:144896890-144896912 CTTTGTAACCAGTGGGTGGGAGG - Intronic
1051103212 9:13546910-13546932 CTTTATATCCAGTGTGTGTTGGG + Intergenic
1055389000 9:75798227-75798249 CTTTTTATGATGTGGCTGCTTGG - Intergenic
1055585328 9:77753305-77753327 CTTTTTCTTCAGGGGGTGGGTGG - Intronic
1058292049 9:103255564-103255586 CTTTTTTAGCATTGGGTAGTTGG - Intergenic
1058772662 9:108251667-108251689 CTTTTTAACAAGTGGGTGCTAGG - Intergenic
1059523274 9:114963908-114963930 CTTTTTATGGAGCGAGTGCTGGG - Intergenic
1059600087 9:115767687-115767709 TTTTTTGTGCAGTGGGATGTAGG + Intergenic
1059660091 9:116391816-116391838 GTGTTCATGCTGTGGGTGGTAGG + Intronic
1060712519 9:125882487-125882509 CTATTTTTTAAGTGGGTGGTTGG + Intronic
1061536157 9:131251603-131251625 CTTTTTGGGCGGTGGGGGGTGGG + Intergenic
1061628397 9:131856035-131856057 CCTTTCATGCAGTCAGTGGTGGG + Intergenic
1061902286 9:133679069-133679091 GTGTTTGTGGAGTGGGTGGTGGG - Intronic
1186753695 X:12647943-12647965 ATTTTTATCCAGAGTGTGGTAGG - Intronic
1187014479 X:15312401-15312423 TTTTTTGTGCAGTGGGCGGGTGG - Intronic
1187544120 X:20230622-20230644 CTTATTATGCAGGGCCTGGTAGG + Intronic
1188559799 X:31454647-31454669 CTTTTGATTCAGTGGGTGTAAGG + Intronic
1188909304 X:35825894-35825916 CTTTTTATTCTTTGGGTTGTAGG - Intergenic
1193240857 X:79167465-79167487 TTTTTTTTCCAGTGGGTGGTAGG + Intergenic
1193338865 X:80322419-80322441 CATTTTAAGCAGTGGGTAGAGGG + Intergenic
1198039298 X:132834071-132834093 CTTTTTAGGGAGTGGGAGGATGG - Intronic
1198818239 X:140615956-140615978 CATTTTATGCAGTTGTTGGGTGG + Intergenic