ID: 1107483633

View in Genome Browser
Species Human (GRCh38)
Location 13:40805688-40805710
Sequence GGGTAAGAATAGTTACCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107483633_1107483641 14 Left 1107483633 13:40805688-40805710 CCTAGAGGTAACTATTCTTACCC 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1107483641 13:40805725-40805747 CCTTCAAGTGTACCTGCAGATGG 0: 1
1: 0
2: 1
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107483633 Original CRISPR GGGTAAGAATAGTTACCTCT AGG (reversed) Intronic
902638770 1:17752764-17752786 GGATAATAATATTTTCCTCTTGG - Intergenic
902765766 1:18613927-18613949 TGATAATAATAGCTACCTCTCGG - Intergenic
903386063 1:22927609-22927631 TCATAAGAATAGTTACTTCTGGG + Intergenic
905007727 1:34723828-34723850 TGGTAAGAGCATTTACCTCTGGG + Intronic
907129392 1:52082041-52082063 GGTTAGGAAGAGTTAACTCTTGG - Intronic
908704409 1:66935686-66935708 TGTTAACAATAGTTACCTCTAGG - Intronic
909009025 1:70311630-70311652 TGTTAACAATAGTCACCTCTGGG + Intronic
910263906 1:85317897-85317919 TGTTAATAATAGTTATCTCTGGG + Intergenic
910966126 1:92809854-92809876 TGATAATAATACTTACCTCTTGG - Intergenic
911360241 1:96866863-96866885 GGGTAAGAATAACTATTTCTAGG + Intergenic
914221083 1:145682471-145682493 GGGTAAGAAAAGTACCCTTTGGG + Intronic
914473655 1:148005344-148005366 GGGTAAGAAAAGTACCCTTTGGG + Intergenic
914872181 1:151484352-151484374 GGTAAAGAATAGCTATCTCTAGG + Intergenic
915048556 1:153041654-153041676 GGACAATAATACTTACCTCTGGG + Exonic
916626082 1:166556626-166556648 GGGTAAGAATTCTTACCAGTCGG + Intergenic
916667531 1:166979956-166979978 GAGTAACAATGGTTATCTCTGGG + Intronic
918011795 1:180593711-180593733 TGGTAAGGCTTGTTACCTCTGGG + Intergenic
918860363 1:189817534-189817556 TGTTAAGAAAAATTACCTCTTGG - Intergenic
919824676 1:201494951-201494973 AGGTAATAATAGTTACCTCATGG - Intronic
920954719 1:210607877-210607899 TGATAATAATGGTTACCTCTTGG - Intronic
921721288 1:218474615-218474637 GGGTAAGAAATGTTATCTTTGGG - Intergenic
921741931 1:218695165-218695187 GAGCAAGAAGAGTTCCCTCTTGG + Intergenic
923623599 1:235596608-235596630 GGCTAACCATAGTTATCTCTGGG - Intronic
1070251828 10:74779852-74779874 AGGTAAGAATATTAACTTCTGGG + Intergenic
1070488291 10:76951816-76951838 GGGGAAGAGGAGTTATCTCTAGG - Intronic
1076116235 10:127903597-127903619 GGTTACTAAAAGTTACCTCTTGG + Intergenic
1079511752 11:21218541-21218563 GGGTAATTATGGTTACCCCTGGG - Intronic
1082849295 11:57751630-57751652 GGATAATAATAGTTACCATTTGG - Exonic
1082992725 11:59222160-59222182 GGGTAAGACCAGGTACCTTTAGG - Intergenic
1085607076 11:77910750-77910772 TGGTAATAGTAGTTGCCTCTGGG - Intronic
1085628832 11:78095652-78095674 TGGTAACAATGGTTGCCTCTTGG + Intergenic
1087649584 11:100848764-100848786 GGGAAAGAAAAGTTACATTTTGG - Intronic
1088316938 11:108517107-108517129 TGTTAAGAATGGTTACCTCTAGG - Intronic
1088814373 11:113411184-113411206 GGGTCAGAATGGTAACCTTTTGG - Intronic
1088954393 11:114604947-114604969 GGATAATAATTGTTGCCTCTAGG + Intergenic
1088954939 11:114608582-114608604 GGATAATAATTGTTGCCTCTAGG + Intergenic
1088956764 11:114620446-114620468 GGGTATTAATTGTTGCCTCTAGG + Intergenic
1089096708 11:115925613-115925635 GGGTAAGAGTAGAAACCTGTGGG - Intergenic
1089223366 11:116894437-116894459 GGGGAAGAATACTTACATTTTGG - Intronic
1091662897 12:2397838-2397860 GAGAAAGCATAGTTAGCTCTCGG + Intronic
1091889529 12:4042208-4042230 GGATAAGAATACTTACCTCTTGG + Intergenic
1092419474 12:8318234-8318256 TAGTTAGAATAGTTAGCTCTGGG + Intergenic
1093478441 12:19580655-19580677 GATTAAGAATAGATACCTTTGGG - Intronic
1095462537 12:42457839-42457861 GGGTAAGAGTGGTTACTTCTGGG + Exonic
1098077535 12:66748899-66748921 ATATAAGAATGGTTACCTCTAGG - Intronic
1098312869 12:69164973-69164995 GGGAAACAAAAGTTACCTATAGG + Intergenic
1098501410 12:71196691-71196713 GGGTAAGAATTCTTACCCATAGG + Intronic
1100332043 12:93592097-93592119 TTTTAATAATAGTTACCTCTGGG - Intergenic
1103251183 12:119501336-119501358 GGGTAAGAATAGTGCCCCATAGG - Intronic
1105926586 13:25014196-25014218 AGGTAAGAATTGTTTCTTCTTGG - Intergenic
1107483633 13:40805688-40805710 GGGTAAGAATAGTTACCTCTAGG - Intronic
1107843389 13:44483851-44483873 AGGTCAGAATAATTACTTCTTGG - Intronic
1108133488 13:47329726-47329748 GGGGAATAATAATTACCCCTAGG - Intergenic
1109255286 13:60072912-60072934 TATTAACAATAGTTACCTCTGGG + Intronic
1111027292 13:82546135-82546157 GAGTGACAACAGTTACCTCTAGG + Intergenic
1112147383 13:96715596-96715618 GGTTAATAATGGTTGCCTCTGGG - Intronic
1113664677 13:112132999-112133021 GGGTTAGAATAGACACCACTGGG - Intergenic
1114197754 14:20494104-20494126 GGTTAAGAATAGTTTACTTTGGG + Intergenic
1114879546 14:26767451-26767473 GCGAAAGAATATCTACCTCTAGG - Intergenic
1117843558 14:59886616-59886638 GGGTAACAGAAGTTATCTCTAGG + Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1122109547 14:99487662-99487684 AGGTCAGAATAGTTATCTTTGGG + Intronic
1125406234 15:39354964-39354986 GGGGAAAAAGAGTTAACTCTGGG - Intergenic
1127077935 15:55346434-55346456 TGATAACAATAGTTACCTCTGGG - Intronic
1127881606 15:63162988-63163010 GGGTATGAAAAGTTATCTTTAGG - Intergenic
1128222628 15:65979908-65979930 GGGTAAGATTTGTAACCTCATGG - Intronic
1128469247 15:67938154-67938176 TGGTAACAGTTGTTACCTCTGGG + Intergenic
1129435738 15:75538848-75538870 TGGTAATAATGGTCACCTCTGGG + Intronic
1133709224 16:8385122-8385144 GCAGAAGAGTAGTTACCTCTTGG - Intergenic
1135795479 16:25437261-25437283 TGTTAACAATGGTTACCTCTGGG - Intergenic
1138113321 16:54341227-54341249 GTGTAAAAATGGTTAACTCTGGG - Intergenic
1140019144 16:71220679-71220701 TATTAAGAATAGTTACCTCTGGG + Intronic
1141081874 16:81060088-81060110 GGTTAAGAATAATTACTTTTTGG - Intronic
1149959485 17:61092038-61092060 TGATAAAAATGGTTACCTCTAGG - Intronic
1151196402 17:72434726-72434748 GGTTAACATTAGTTATCTCTGGG + Intergenic
1152051804 17:77984907-77984929 GGGTAAAAATAGTTCCTTATGGG - Intergenic
1153170993 18:2315441-2315463 CAGGAAAAATAGTTACCTCTTGG + Intergenic
1153254621 18:3158117-3158139 TGGTAATAGTAGTTATCTCTGGG - Intronic
1157241285 18:46011718-46011740 GGCTACCAATAGTTATCTCTGGG + Intronic
1157821411 18:50773593-50773615 AGGTAAGTATAGTTATTTCTGGG - Intergenic
1159662517 18:71115960-71115982 GGGTATAAATAGTTTCCTCAGGG - Intergenic
1166596765 19:44056932-44056954 GGGCAAAAATATTTACCCCTTGG + Intronic
1166711997 19:44943818-44943840 GGGTAATAATATCTACCTCAGGG - Intronic
926276810 2:11409950-11409972 GGGTAATAATTCTTACCTCCTGG + Intergenic
926412959 2:12624055-12624077 GGATAAGAATGTTTGCCTCTAGG + Intergenic
930724389 2:54668232-54668254 GGGTAAGCAGAGTCACTTCTGGG - Intronic
932827734 2:74957142-74957164 GCATAAAAATAGTTTCCTCTAGG + Intergenic
933362137 2:81301239-81301261 GGGTATGAATATTTACATCATGG - Intergenic
937134301 2:119539628-119539650 TGGTAACATGAGTTACCTCTGGG + Intergenic
941072949 2:160975319-160975341 GGGTAAGAAATGTTATATCTAGG - Intergenic
941158757 2:162011081-162011103 GGGTAAGAACACCCACCTCTCGG + Intronic
941668730 2:168267686-168267708 GGATAATAGTAGTTACTTCTAGG - Intergenic
942684131 2:178512902-178512924 AGAAAAGAATGGTTACCTCTAGG - Exonic
944075383 2:195723775-195723797 GGGTTAGAAAACTTACCTATTGG + Intronic
944689491 2:202146896-202146918 GGGTAATAATATTTCCCTCATGG + Intronic
947664156 2:231892770-231892792 GGATAAGAATAGTAACCACCCGG + Intergenic
947896921 2:233683108-233683130 TGCTAAGAATATTTTCCTCTGGG - Intronic
948129521 2:235590309-235590331 GGTTAAGAATATTTATCTTTGGG - Intronic
1169793253 20:9434264-9434286 GGATAATAATAGTTACCTTCTGG + Intronic
1170490955 20:16873844-16873866 TGGTAACAGTGGTTACCTCTGGG + Intergenic
1178222301 21:30674050-30674072 GGGGGAAAAGAGTTACCTCTAGG - Intergenic
1178397969 21:32259324-32259346 GGGAAAGAATTGTAACCCCTGGG - Intergenic
1182204166 22:28606522-28606544 GAATAAAAATAGTTAACTCTAGG + Intronic
1183225656 22:36548293-36548315 GTGTAAGAGTAGTCACCTCTGGG - Intergenic
949343359 3:3052764-3052786 GGGTGACAATGGTTGCCTCTTGG + Intronic
949597694 3:5565234-5565256 GTGTAAGAAGAGCTTCCTCTAGG - Intergenic
951445711 3:22777865-22777887 GGGTTAAAAAAATTACCTCTTGG - Intergenic
953092960 3:39747791-39747813 GGGTAAGAAAAGTAATTTCTTGG + Intergenic
953403499 3:42647772-42647794 GGTTAAGAAAAGTTACCCTTGGG + Exonic
955496788 3:59541869-59541891 GGTTAAGAATAGTAATTTCTAGG + Intergenic
956688182 3:71851662-71851684 GAATAAGAATACTTACCTCATGG - Intergenic
956936205 3:74104836-74104858 GGGCAAGAATAATTCCTTCTTGG - Intergenic
960010301 3:112827128-112827150 TGGCAAGAATAGATCCCTCTGGG + Exonic
963985052 3:151582977-151582999 GGGTAAGAAAATAAACCTCTAGG - Intergenic
964131639 3:153294987-153295009 GGTTAAAAATAGTTGCCACTAGG + Intergenic
964315802 3:155443062-155443084 AGGTAATAATAGCTACCTCCTGG + Intronic
965115822 3:164486730-164486752 AGGTAATAATGGTTACCTCAGGG + Intergenic
965619367 3:170627050-170627072 CGGTAATAATGGTTACCTCTAGG - Intronic
968680086 4:1912188-1912210 AGATAAAAATAATTACCTCTGGG - Intronic
970405517 4:15759370-15759392 TAGTAAGAATATTTACCTCATGG + Intergenic
971424866 4:26505576-26505598 TGGTAACAATGGTTACTTCTAGG - Intergenic
975860297 4:78670019-78670041 TGTTAAGATTAGTTATCTCTGGG - Intergenic
977327951 4:95601118-95601140 GGGTAATAATATTCACCTCATGG + Intergenic
977950423 4:102964528-102964550 GGTTAAGAATATTTATGTCTAGG - Intronic
977974540 4:103248987-103249009 GGGGATGAAAAGTTACCTATTGG - Intergenic
980817759 4:137969761-137969783 TTGTAAGAGTATTTACCTCTGGG - Intergenic
981907730 4:149941863-149941885 GGTTAAGAATAGTAATCTCTTGG + Intergenic
982403107 4:154990404-154990426 GGCTAAGAAAAGTTATCACTGGG - Intergenic
982490905 4:156028413-156028435 GGAAAAGAATAGTTTCCACTTGG - Intergenic
983226272 4:165089084-165089106 GCATAAGAATAGTTTTCTCTGGG - Intronic
985001693 4:185491324-185491346 TGGTAAGAACAGTGAGCTCTGGG - Intergenic
986559380 5:9045527-9045549 TGCTTATAATAGTTACCTCTAGG - Intronic
989470313 5:41809208-41809230 TGCTAAGAATTGTTATCTCTGGG + Intronic
990833692 5:59990214-59990236 AGATAATAATATTTACCTCTCGG + Intronic
991218087 5:64179374-64179396 AGTTTAGAATAGTAACCTCTAGG - Intronic
992228800 5:74643291-74643313 GGGTGATAAGAGTTACCTTTAGG - Intronic
992373364 5:76168159-76168181 GGGCAGGAGTAGGTACCTCTGGG - Intronic
992495571 5:77290106-77290128 GGGTAATAATACTTACCCCTTGG - Intronic
995540360 5:113180011-113180033 GGGTGAGAATAGAAATCTCTAGG - Intronic
998765223 5:145478967-145478989 GGGGAAGAATTGTGACTTCTGGG - Intronic
1000454738 5:161436145-161436167 GTGTAAAAATAGCCACCTCTTGG + Intronic
1000810988 5:165861120-165861142 GATTAACAATATTTACCTCTGGG - Intergenic
1002185545 5:177453214-177453236 GGGTCAGAAAAGGTAACTCTGGG - Intronic
1007441146 6:41861532-41861554 AGTTAACAGTAGTTACCTCTAGG - Intronic
1010229772 6:73523829-73523851 GCGGAAGAAAAGTTACCTCAAGG - Intergenic
1011635067 6:89364143-89364165 TGGTAACAGTACTTACCTCTTGG + Intergenic
1013266050 6:108499917-108499939 GGGTTAGAAAAATTACCTATTGG - Intronic
1016459790 6:144270276-144270298 AGTTAAAAATAGATACCTCTGGG - Intergenic
1019063031 6:169270766-169270788 GGATAAAAATAGTCACCGCTGGG + Intergenic
1021153564 7:17181537-17181559 GGGTAATAAGAGTTTCCTCATGG - Intergenic
1021188030 7:17588131-17588153 GGCTAAGAAAAATTACCTATTGG + Intergenic
1022739249 7:33105816-33105838 GCATAAAAATAGTTTCCTCTGGG + Intronic
1023136728 7:37060085-37060107 GGGTAATAATTCTTACCTCATGG - Intronic
1025845926 7:65197468-65197490 TGGTAATAGTAGTTGCCTCTGGG + Intergenic
1025896151 7:65703176-65703198 TGGTAATAGTAGTTGCCTCTGGG + Intergenic
1027140268 7:75651743-75651765 GGCTAATCATAGCTACCTCTTGG + Intronic
1033185118 7:139220326-139220348 ATGTCAGAATGGTTACCTCTGGG + Intergenic
1034827613 7:154280853-154280875 GGATAACAATGGTTACCTCGTGG - Intronic
1037581926 8:20250392-20250414 GGGTAAGGACACTCACCTCTTGG - Intronic
1038387938 8:27167071-27167093 GGGTAACAAAACTTCCCTCTAGG - Intergenic
1038731652 8:30133275-30133297 TTTTAAGAATAGTTACCTCTAGG + Intronic
1040638511 8:49303913-49303935 GGGAATGAAAAGTTGCCTCTAGG - Intergenic
1042344906 8:67717507-67717529 GGGTAAGAGTGGTTATCTCTTGG - Intronic
1045343771 8:101276316-101276338 GGGTATGAACACCTACCTCTGGG + Intergenic
1045356208 8:101391386-101391408 TGATAATAATAGTTACCTCAAGG - Intergenic
1045663615 8:104463959-104463981 GGGTGGGAGTGGTTACCTCTTGG + Intronic
1050844441 9:10196684-10196706 TGGTAGGCATAGTTACCTCAGGG + Intronic
1055148504 9:72965463-72965485 GGTCAAGACTAGTTACCTCCTGG - Intronic
1062457671 9:136647100-136647122 GGGTAAGGATGGATACCTCTCGG - Intergenic
1062621748 9:137425924-137425946 TGTTAATAATAGTTACCTCTGGG - Intronic
1187237493 X:17481801-17481823 GAGTCAGAATAGTTGCCTCTGGG - Intronic
1192137192 X:68614375-68614397 GGTTAAAAATAGCTAACTCTGGG + Intergenic
1194657658 X:96592804-96592826 AGGTAAGAAGAGTGACTTCTTGG + Intergenic
1194824241 X:98541704-98541726 GGGTCAGGATTGCTACCTCTTGG - Intergenic
1197532578 X:127647931-127647953 AAGTAAAAATGGTTACCTCTAGG + Intergenic
1201943324 Y:19483074-19483096 GGGTAAGGAAAGTAACTTCTGGG + Intergenic