ID: 1107483728

View in Genome Browser
Species Human (GRCh38)
Location 13:40806761-40806783
Sequence CTGGTTGCCCTCAATCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107483723_1107483728 4 Left 1107483723 13:40806734-40806756 CCTGTTCTTAGCAGGGATAAACC 0: 1
1: 1
2: 0
3: 2
4: 71
Right 1107483728 13:40806761-40806783 CTGGTTGCCCTCAATCATGAAGG 0: 1
1: 0
2: 0
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107483728 Original CRISPR CTGGTTGCCCTCAATCATGA AGG Intronic
902923405 1:19680489-19680511 CTGGTTTTCCTCAATCCTGGGGG + Intergenic
903414783 1:23174895-23174917 ACGGTTGCCCTGAAACATGAGGG - Intronic
905223927 1:36467232-36467254 CTGGGTGCCCACAATCATGGAGG - Exonic
909468597 1:76001680-76001702 CTCCTTGCCTTCCATCATGATGG + Intergenic
909696284 1:78471524-78471546 CAGGTTGCCCTCCATCGTGTGGG + Intronic
912224861 1:107721816-107721838 ATGGTGGCCCTCAGTCATGCTGG - Intronic
915673042 1:157506284-157506306 CAGGTTGCCTTCGGTCATGATGG - Intergenic
915962605 1:160279591-160279613 CTGGATGCCCTCAATCTTTCGGG - Exonic
919970167 1:202571185-202571207 CTAGTTGCCCTCAATTCTGTAGG + Intronic
921373157 1:214446397-214446419 CAGGTTTCCCTCACTTATGAAGG + Intronic
921861275 1:220044894-220044916 GTCTTTGCTCTCAATCATGAAGG + Intronic
922128678 1:222755323-222755345 CTGCTTGGCGTCAATCATGGTGG + Intergenic
1064506508 10:16036329-16036351 CTGGTTGACTTCAATCAACAGGG + Intergenic
1070055617 10:72931898-72931920 CTGATTGCCCTCAATCAGGCAGG + Intronic
1071909923 10:90220052-90220074 CTGGCTGCCCTGAAGCATCACGG + Intergenic
1072525621 10:96268943-96268965 CTGGTTGACATCAATTCTGAAGG - Intronic
1075565826 10:123503522-123503544 CTTGTTTCCCTGAATCAGGAAGG - Intergenic
1075836761 10:125460498-125460520 CTGATTGCCCTCCATAATGTGGG + Intergenic
1077886656 11:6392057-6392079 GTGGTTGCCCTCAATGAAGGGGG - Exonic
1079024672 11:16937000-16937022 CTGGTAGTCCTCAAAGATGAGGG - Intronic
1081506174 11:43719389-43719411 CTTGTTACCCTCAACCATGGAGG - Intronic
1083791138 11:64986839-64986861 CAGGTTGCCCTCCATAATGTAGG + Intergenic
1084019042 11:66406494-66406516 GTGGTTGCCCTTAATACTGATGG - Intergenic
1085182173 11:74545188-74545210 CTAGTTGCCCTAATTGATGAGGG + Intronic
1091635918 12:2196577-2196599 ATGGTTGCCATAAATCATAATGG + Intronic
1095990138 12:48028889-48028911 CTGCCTGCCCTCAAGAATGAGGG + Intergenic
1098104885 12:67059173-67059195 CTGTTTTCTCTGAATCATGATGG - Intergenic
1105967318 13:25396603-25396625 CGGGTAGCCTGCAATCATGAGGG + Intronic
1107126356 13:36850874-36850896 TTAGTTGCCTTCAATCAAGATGG - Intronic
1107483728 13:40806761-40806783 CTGGTTGCCCTCAATCATGAAGG + Intronic
1113576235 13:111397054-111397076 CTGGTTGGGCTCAAGAATGATGG + Intergenic
1113659431 13:112095534-112095556 CTGTGTGCCCTCCATCATCAGGG + Intergenic
1117968143 14:61226697-61226719 CTGGGTTCTCTTAATCATGAAGG + Intronic
1121944884 14:98110367-98110389 CTGCTTGCTCTCTATTATGAGGG - Intergenic
1129272717 15:74427937-74427959 CTGGCTGCCCTCCATGATGAGGG + Intronic
1130396714 15:83508780-83508802 CTGGTTGGCCACCATCATGTTGG + Intronic
1131073474 15:89480228-89480250 ATGGTGGCCCTCGGTCATGATGG + Intronic
1131858970 15:96631188-96631210 CTGCTTGCCCTTAATCTTCATGG - Intergenic
1131862725 15:96671457-96671479 CTGGATGTCCTCATTTATGAAGG - Intergenic
1134244080 16:12526904-12526926 CTGGTTGCCATCAGTCAGCACGG + Intronic
1141507727 16:84489850-84489872 TTGCTTGCCCTCTATCATTATGG - Intronic
1142680387 17:1544413-1544435 CTGGTTTTCCGAAATCATGAGGG + Intronic
1144793767 17:17877411-17877433 CTGGCTGCCCTCCAGCTTGATGG + Intronic
1146788976 17:35741058-35741080 CTTGTTGCCCACGATGATGATGG - Exonic
1148093794 17:45038759-45038781 CTGCTTGGCCTCCATCAGGAAGG + Intronic
1157160975 18:45314168-45314190 CTTCTTGCCCTTGATCATGAGGG + Intronic
1160324039 18:77925018-77925040 CTGCTTGCCCTCATATATGATGG - Intergenic
1163182188 19:15612369-15612391 CTTGTTACCCTCAACCATGGAGG - Intergenic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
925114812 2:1369705-1369727 CTGGGTGTAATCAATCATGAAGG - Intergenic
931459387 2:62437133-62437155 CTGGTGGCCCCCTATCAGGAGGG + Intergenic
935359001 2:102231883-102231905 CTGGTGGGCCTGAATCAAGAGGG + Intronic
940060061 2:149555515-149555537 ATGGTTGCCCTCAATAAAAAAGG - Intergenic
942017050 2:171828160-171828182 CTAGTTGCCCTCAATTACCAAGG - Intronic
942452246 2:176115865-176115887 CTGTTTGCCCTCCATTATCAGGG + Intronic
943418810 2:187640248-187640270 GTGGTTGCCCTCAATTATTTAGG - Intergenic
944668087 2:201973124-201973146 CTGGCTGCCCTGAATGCTGACGG - Intergenic
944927498 2:204479946-204479968 CTGCTTGGCCTCAGTCATGCTGG + Intergenic
1168880268 20:1200465-1200487 CTAGTTGCCCTCATTCCTCACGG - Intergenic
1174742655 20:53030539-53030561 ATGGTTGCCCTTTATAATGAGGG + Intronic
1175644907 20:60662878-60662900 CTGCTTGCCTTCACTCATGCTGG - Intergenic
1177897402 21:26870500-26870522 CTGGTGGCTCTCACTCATCAAGG - Intergenic
1178732284 21:35115764-35115786 CAGGTTGCCCTCCATAATGTGGG - Intronic
1181476106 22:23168722-23168744 CTGGTGGCCCTGAATACTGAGGG - Intergenic
949218059 3:1595594-1595616 CTTGTTACCCTCAACCATGGAGG + Intergenic
952185419 3:30962706-30962728 CTGGAAGCTCGCAATCATGATGG + Intergenic
955012078 3:55027485-55027507 CTGGATGCCACCAATCATGCTGG - Intronic
959052347 3:101536314-101536336 GAGGTGGCCCCCAATCATGAGGG + Intergenic
961041751 3:123683010-123683032 CTGCTTGCCCTCCATGAGGAAGG - Intronic
962270941 3:133977737-133977759 CATGTTGTCCTCACTCATGATGG - Intronic
965857358 3:173104494-173104516 CAGGTTGCTTTTAATCATGATGG + Intronic
969192328 4:5532313-5532335 CAGGTTGCCCTCCATAATGTGGG - Intergenic
969306796 4:6330471-6330493 CAGGCTGCCCTCCATCATGTGGG + Intronic
971577198 4:28290689-28290711 CTGCTTGACTTCAGTCATGATGG + Intergenic
982636674 4:157905540-157905562 CTGGTAGGCCTTAAGCATGAAGG - Intergenic
985093679 4:186390502-186390524 CAGGTTGCCCTCAATAATGTAGG - Intergenic
988394322 5:30678348-30678370 CTCCTTGCCTTCCATCATGATGG + Intergenic
989205427 5:38804847-38804869 CAGATTGCCCTCCATAATGAGGG - Intergenic
992072151 5:73158122-73158144 CAGGCTGCTCTCACTCATGATGG + Intergenic
992987103 5:82242043-82242065 CTGCTGGCCCTCATTCATAATGG - Intronic
994471472 5:100213087-100213109 CTGGTTGCACTTAAACATCAAGG + Intergenic
995150058 5:108832864-108832886 CTGCTTGTCCTTAATCATCATGG - Exonic
1000904792 5:166952208-166952230 CTGGTTTCAATCCATCATGAGGG - Intergenic
1006113131 6:31760817-31760839 CTGGTTGAGGTCGATCATGAAGG - Exonic
1007308991 6:40930119-40930141 CTGGTTGCCCTCTCTCCTGAAGG + Intergenic
1015412170 6:132906183-132906205 CTGGTTGCCCTTAATCTTAATGG - Intergenic
1018535238 6:164812266-164812288 GTGGTGGCACTCAATCATCAAGG - Intergenic
1029578837 7:101421336-101421358 CAGGTTGCCCTCTATAATGTGGG - Intronic
1034789398 7:153954637-153954659 CAGGTTACCCTCCATCATGTGGG + Intronic
1038397025 8:27254413-27254435 CTGGATGGCCTGATTCATGATGG - Intronic
1041731566 8:61068455-61068477 CTGGTGGCCCTCAAGCTTGCAGG + Intronic
1043821594 8:84872831-84872853 CTGGTTTCCATCAATCTTCAAGG + Intronic
1049060914 8:140275449-140275471 CTGGTTTCCCACTGTCATGATGG + Intronic
1049144380 8:140987661-140987683 CTGGTTGCTCTGCATCATTAGGG - Intronic
1049877587 8:145035630-145035652 CTTGATGGCCTCAATCCTGAAGG - Intergenic
1050794118 9:9515068-9515090 CTGGTTTCTCTCAATCATTCAGG + Intronic
1052032603 9:23645519-23645541 CTGGTGGCCCCCAAGCCTGAGGG - Intergenic
1052488014 9:29127663-29127685 CCGGTTGCCCTCAATTACTAAGG - Intergenic
1057172090 9:92969160-92969182 CGGGTGGCCCAGAATCATGAGGG - Intronic
1059149593 9:111937497-111937519 CTGGTGTCCGTCAGTCATGAGGG - Intergenic
1062256731 9:135626730-135626752 CTGGTGGGCCTAAAGCATGAGGG - Intronic
1062298561 9:135849427-135849449 CTGCTTGGCCTCAGTCATCAAGG - Intronic
1062424367 9:136499210-136499232 CTGGATGCCCGCATGCATGATGG - Exonic
1192597261 X:72424304-72424326 CTGGTTGCCCAACATTATGAAGG - Intronic
1198243414 X:134806881-134806903 CTTGTTGGCCTCAGTCATAAAGG + Intronic
1199693248 X:150325139-150325161 CAGGTTGCCCTCCATTATGTAGG - Intergenic