ID: 1107487398

View in Genome Browser
Species Human (GRCh38)
Location 13:40842381-40842403
Sequence GCTTGGTATTGGTCAGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107487398_1107487408 30 Left 1107487398 13:40842381-40842403 CCCTGACCTGACCAATACCAAGC No data
Right 1107487408 13:40842434-40842456 TATGAACCAGCAGGGCGCAATGG No data
1107487398_1107487406 22 Left 1107487398 13:40842381-40842403 CCCTGACCTGACCAATACCAAGC No data
Right 1107487406 13:40842426-40842448 AAAAAACCTATGAACCAGCAGGG No data
1107487398_1107487405 21 Left 1107487398 13:40842381-40842403 CCCTGACCTGACCAATACCAAGC No data
Right 1107487405 13:40842425-40842447 TAAAAAACCTATGAACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107487398 Original CRISPR GCTTGGTATTGGTCAGGTCA GGG (reversed) Intergenic