ID: 1107489935

View in Genome Browser
Species Human (GRCh38)
Location 13:40872084-40872106
Sequence GTGAGCCATGCTTATACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107489935_1107489939 3 Left 1107489935 13:40872084-40872106 CCAGTGGTATAAGCATGGCTCAC No data
Right 1107489939 13:40872110-40872132 GCTAATCCTGGCATTTTGGGAGG No data
1107489935_1107489938 0 Left 1107489935 13:40872084-40872106 CCAGTGGTATAAGCATGGCTCAC No data
Right 1107489938 13:40872107-40872129 ACAGCTAATCCTGGCATTTTGGG No data
1107489935_1107489937 -1 Left 1107489935 13:40872084-40872106 CCAGTGGTATAAGCATGGCTCAC No data
Right 1107489937 13:40872106-40872128 CACAGCTAATCCTGGCATTTTGG No data
1107489935_1107489941 9 Left 1107489935 13:40872084-40872106 CCAGTGGTATAAGCATGGCTCAC No data
Right 1107489941 13:40872116-40872138 CCTGGCATTTTGGGAGGCTGAGG 0: 31
1: 1078
2: 14987
3: 119006
4: 247639
1107489935_1107489942 13 Left 1107489935 13:40872084-40872106 CCAGTGGTATAAGCATGGCTCAC No data
Right 1107489942 13:40872120-40872142 GCATTTTGGGAGGCTGAGGCAGG 0: 2950
1: 69895
2: 192442
3: 319640
4: 368867
1107489935_1107489936 -9 Left 1107489935 13:40872084-40872106 CCAGTGGTATAAGCATGGCTCAC No data
Right 1107489936 13:40872098-40872120 ATGGCTCACACAGCTAATCCTGG No data
1107489935_1107489943 16 Left 1107489935 13:40872084-40872106 CCAGTGGTATAAGCATGGCTCAC No data
Right 1107489943 13:40872123-40872145 TTTTGGGAGGCTGAGGCAGGAGG 0: 1612
1: 31176
2: 92073
3: 173327
4: 187080

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107489935 Original CRISPR GTGAGCCATGCTTATACCAC TGG (reversed) Intergenic
No off target data available for this crispr