ID: 1107490278

View in Genome Browser
Species Human (GRCh38)
Location 13:40874888-40874910
Sequence CCTTTTAAGCAGTCAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107490278_1107490283 -1 Left 1107490278 13:40874888-40874910 CCAGCCACTGACTGCTTAAAAGG No data
Right 1107490283 13:40874910-40874932 GTGGCTGCTTTCTTTGTCCAGGG 0: 5
1: 8
2: 4
3: 25
4: 245
1107490278_1107490282 -2 Left 1107490278 13:40874888-40874910 CCAGCCACTGACTGCTTAAAAGG No data
Right 1107490282 13:40874909-40874931 GGTGGCTGCTTTCTTTGTCCAGG 0: 11
1: 3
2: 6
3: 34
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107490278 Original CRISPR CCTTTTAAGCAGTCAGTGGC TGG (reversed) Intergenic
No off target data available for this crispr