ID: 1107490752

View in Genome Browser
Species Human (GRCh38)
Location 13:40878175-40878197
Sequence GTTCCAGGCAGACTGACAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107490743_1107490752 14 Left 1107490743 13:40878138-40878160 CCTTGGTTCCTGGATTGGGAACA No data
Right 1107490752 13:40878175-40878197 GTTCCAGGCAGACTGACAGGGGG No data
1107490745_1107490752 6 Left 1107490745 13:40878146-40878168 CCTGGATTGGGAACAGGCAGCAG No data
Right 1107490752 13:40878175-40878197 GTTCCAGGCAGACTGACAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107490752 Original CRISPR GTTCCAGGCAGACTGACAGG GGG Intergenic
No off target data available for this crispr