ID: 1107495737

View in Genome Browser
Species Human (GRCh38)
Location 13:40924041-40924063
Sequence GTGTTCTAAGAGATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107495730_1107495737 12 Left 1107495730 13:40924006-40924028 CCCAAAACAAAGGGCCTTGCTCC No data
Right 1107495737 13:40924041-40924063 GTGTTCTAAGAGATGGAGCAGGG No data
1107495729_1107495737 20 Left 1107495729 13:40923998-40924020 CCATTTAACCCAAAACAAAGGGC No data
Right 1107495737 13:40924041-40924063 GTGTTCTAAGAGATGGAGCAGGG No data
1107495731_1107495737 11 Left 1107495731 13:40924007-40924029 CCAAAACAAAGGGCCTTGCTCCA No data
Right 1107495737 13:40924041-40924063 GTGTTCTAAGAGATGGAGCAGGG No data
1107495726_1107495737 23 Left 1107495726 13:40923995-40924017 CCTCCATTTAACCCAAAACAAAG 0: 16
1: 59
2: 70
3: 107
4: 315
Right 1107495737 13:40924041-40924063 GTGTTCTAAGAGATGGAGCAGGG No data
1107495733_1107495737 -9 Left 1107495733 13:40924027-40924049 CCACTGTACAGCCTGTGTTCTAA No data
Right 1107495737 13:40924041-40924063 GTGTTCTAAGAGATGGAGCAGGG No data
1107495732_1107495737 -2 Left 1107495732 13:40924020-40924042 CCTTGCTCCACTGTACAGCCTGT No data
Right 1107495737 13:40924041-40924063 GTGTTCTAAGAGATGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107495737 Original CRISPR GTGTTCTAAGAGATGGAGCA GGG Intergenic
No off target data available for this crispr