ID: 1107498534

View in Genome Browser
Species Human (GRCh38)
Location 13:40953135-40953157
Sequence CTGAAAATACAGAATTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46528
Summary {0: 6, 1: 418, 2: 9235, 3: 22516, 4: 14353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107498534_1107498538 2 Left 1107498534 13:40953135-40953157 CCCAGCTAATTCTGTATTTTCAG 0: 6
1: 418
2: 9235
3: 22516
4: 14353
Right 1107498538 13:40953160-40953182 GAGACGGGATTTCTCCATGTTGG 0: 319
1: 9924
2: 65943
3: 151892
4: 137847
1107498534_1107498540 11 Left 1107498534 13:40953135-40953157 CCCAGCTAATTCTGTATTTTCAG 0: 6
1: 418
2: 9235
3: 22516
4: 14353
Right 1107498540 13:40953169-40953191 TTTCTCCATGTTGGTCAGGCTGG 0: 18586
1: 36319
2: 134688
3: 174060
4: 144372
1107498534_1107498539 7 Left 1107498534 13:40953135-40953157 CCCAGCTAATTCTGTATTTTCAG 0: 6
1: 418
2: 9235
3: 22516
4: 14353
Right 1107498539 13:40953165-40953187 GGGATTTCTCCATGTTGGTCAGG 0: 614
1: 14236
2: 36234
3: 119928
4: 185048

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107498534 Original CRISPR CTGAAAATACAGAATTAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr