ID: 1107498534 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:40953135-40953157 |
| Sequence | CTGAAAATACAGAATTAGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 46528 | |||
| Summary | {0: 6, 1: 418, 2: 9235, 3: 22516, 4: 14353} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1107498534_1107498538 | 2 | Left | 1107498534 | 13:40953135-40953157 | CCCAGCTAATTCTGTATTTTCAG | 0: 6 1: 418 2: 9235 3: 22516 4: 14353 |
||
| Right | 1107498538 | 13:40953160-40953182 | GAGACGGGATTTCTCCATGTTGG | 0: 319 1: 9924 2: 65943 3: 151892 4: 137847 |
||||
| 1107498534_1107498540 | 11 | Left | 1107498534 | 13:40953135-40953157 | CCCAGCTAATTCTGTATTTTCAG | 0: 6 1: 418 2: 9235 3: 22516 4: 14353 |
||
| Right | 1107498540 | 13:40953169-40953191 | TTTCTCCATGTTGGTCAGGCTGG | 0: 18586 1: 36319 2: 134688 3: 174060 4: 144372 |
||||
| 1107498534_1107498539 | 7 | Left | 1107498534 | 13:40953135-40953157 | CCCAGCTAATTCTGTATTTTCAG | 0: 6 1: 418 2: 9235 3: 22516 4: 14353 |
||
| Right | 1107498539 | 13:40953165-40953187 | GGGATTTCTCCATGTTGGTCAGG | 0: 614 1: 14236 2: 36234 3: 119928 4: 185048 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1107498534 | Original CRISPR | CTGAAAATACAGAATTAGCT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||