ID: 1107503439

View in Genome Browser
Species Human (GRCh38)
Location 13:41005425-41005447
Sequence TAGGTATAGCAGAGGTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107503439 Original CRISPR TAGGTATAGCAGAGGTTGGG GGG (reversed) Intronic
900708185 1:4093833-4093855 AAGGTACAAGAGAGGTTGGGTGG - Intergenic
901326681 1:8370561-8370583 TAGGCATAACAGTGGTTGAGAGG - Intronic
901573358 1:10179966-10179988 TGTGTCTAGCAGAGGGTGGGCGG - Exonic
902302764 1:15514196-15514218 TTGTTATAGCTGAGGGTGGGTGG - Intronic
902379458 1:16045763-16045785 CAGGTGCAGCGGAGGTTGGGGGG + Intronic
902698059 1:18153707-18153729 TAGGGATGGCAGAGGTGGTGGGG + Intronic
902825815 1:18973481-18973503 TAGGTATAAAAGAGGCAGGGAGG - Intergenic
904906257 1:33899390-33899412 CAGAAAGAGCAGAGGTTGGGAGG + Intronic
911313925 1:96332869-96332891 TATGATTAGCAGAGGCTGGGAGG - Intergenic
916150368 1:161782679-161782701 TAGGTAGTGCAGAGGTAGAGAGG - Intronic
916961918 1:169897057-169897079 GAGACATAGCAGAAGTTGGGAGG + Intergenic
917000358 1:170351251-170351273 TAGGAATTGGAGAGGTGGGGTGG - Intergenic
918682981 1:187378363-187378385 TAGGGGTCGCAGAGGTTGAGAGG - Intergenic
920198025 1:204242557-204242579 TAGGTTTGGAAGAGGTTGTGTGG - Intronic
921874186 1:220175709-220175731 TGGGTAGAGGAGAGGTTGGTTGG - Intronic
922916706 1:229263812-229263834 TATTTTTAGTAGAGGTTGGGGGG + Intergenic
1065389348 10:25166793-25166815 TAGGGACAGCAGAGGTCTGGAGG + Intergenic
1067057014 10:43058300-43058322 AAGGTAGACCACAGGTTGGGCGG - Intergenic
1068363083 10:56006254-56006276 TAGGTAAAGCAGAAGATGAGAGG - Intergenic
1069784646 10:70979948-70979970 TCGGCAGAGCAGAGGTTGTGAGG + Intergenic
1072371328 10:94768734-94768756 TAGGTATACCACTGGTTGTGGGG + Intronic
1072763607 10:98078663-98078685 GAGGTATAGAAGAGGGTGCGGGG - Intergenic
1075875485 10:125802734-125802756 TAGGTACAGCCCAGGTAGGGAGG + Intronic
1076187523 10:128460893-128460915 CAGGCAGAGCAGAGGTTGGGAGG - Intergenic
1076350954 10:129814911-129814933 TAGGAATAGCAGAGATGGGAGGG - Intergenic
1081703892 11:45169024-45169046 CAGGTACAGCAGTGGTTGGGAGG + Intronic
1083163518 11:60869788-60869810 ATGGTAAAGCAGGGGTTGGGTGG - Exonic
1090405340 11:126473065-126473087 TAGGTAGAGAAGAGGATGGTGGG - Intronic
1091804225 12:3344244-3344266 TAGCAAAAGCTGAGGTTGGGAGG + Intergenic
1095351500 12:41219216-41219238 TAGTTCTAGCTGAGGTTGGTGGG + Intronic
1097262663 12:57728201-57728223 TAGGGAAAGCAGAGGGTGGGGGG + Intronic
1098034310 12:66286763-66286785 TAGGTAGAGCAGATCTGGGGAGG + Intergenic
1103708685 12:122895403-122895425 TAGATCTGGTAGAGGTTGGGGGG - Intronic
1106104097 13:26718738-26718760 GAGGTATTGCAGAGGGTGTGCGG + Intergenic
1107025231 13:35794925-35794947 TAGGAATAGCAGAGTGTGGGAGG + Intronic
1107503439 13:41005425-41005447 TAGGTATAGCAGAGGTTGGGGGG - Intronic
1111155531 13:84318365-84318387 TAGGTATAGCAGAGGAAGAAAGG - Intergenic
1114631083 14:24160052-24160074 TAGGTCTTGCAGTGGGTGGGAGG + Intronic
1118931905 14:70250606-70250628 TAGGTATAGCAGAAGTAAGGGGG - Intergenic
1118953275 14:70454568-70454590 CAGGTATAGCAGAAGTAAGGGGG + Intronic
1119777941 14:77259778-77259800 GAGGTGGAGGAGAGGTTGGGTGG + Intergenic
1122242442 14:100377774-100377796 AAGGTGTGGAAGAGGTTGGGTGG + Intronic
1127338817 15:58019627-58019649 TAGGTTTCTCAGAGGTTGGAGGG + Intronic
1130965637 15:88695643-88695665 TATGTCTAGCAGAATTTGGGGGG - Intergenic
1133463290 16:6006048-6006070 TAGGTGGTGCAGAGGTTGAGAGG + Intergenic
1139822314 16:69730247-69730269 TAGAGATGGCAGAGGTGGGGGGG - Intergenic
1143691952 17:8575548-8575570 TAGGTACAGTACAGCTTGGGTGG + Intronic
1144382722 17:14718702-14718724 TAGGTTTAGATGAGGTTGTGAGG - Intergenic
1144497571 17:15758205-15758227 TGGGTGCAGCAGAGCTTGGGAGG - Intergenic
1146573324 17:33970954-33970976 TAGGTATAGCAAAGGCAGGCTGG - Intronic
1146859993 17:36288806-36288828 TAAGTATAGCAGTGGCTTGGAGG + Intronic
1147090319 17:38092899-38092921 TAAGTATAGCAGTGGCTTGGAGG + Intergenic
1147106894 17:38227627-38227649 TAAGTATAGCAGTGGCTTGGAGG - Intergenic
1148165028 17:45477556-45477578 TAGTTACAACAGAGGTTGTGTGG - Intronic
1148422633 17:47560917-47560939 TAAGTATAGCAGTGGCTTGGAGG + Intronic
1148909733 17:50935021-50935043 TATGTCTAGCAGAGTCTGGGTGG + Intergenic
1150305513 17:64081672-64081694 AAGATATAGAAAAGGTTGGGGGG - Intronic
1150396258 17:64824281-64824303 TAGTTACAACAGAGGTTGTGTGG - Intergenic
1150644694 17:66970677-66970699 TAGGTTTAGATGAGGTTGTGAGG - Intronic
1151971454 17:77459546-77459568 AAGGAATAGCCGAGGCTGGGGGG + Intronic
1152020547 17:77778085-77778107 TAATTATAGCAAAGGTTTGGAGG - Intergenic
1157227924 18:45884497-45884519 CAGGTACAGCAGAGGCTGAGAGG - Intronic
1159949741 18:74474337-74474359 TTGGTGTGGGAGAGGTTGGGGGG - Intergenic
1160266229 18:77342516-77342538 TAAGTGTGGCAGGGGTTGGGTGG + Intergenic
1161494447 19:4579904-4579926 TAGGGAGAGCACAGGTTGTGGGG - Intergenic
1164443572 19:28298683-28298705 TGGGCAGAGCTGAGGTTGGGGGG - Intergenic
925005605 2:440954-440976 CAGGTGGAGCAGAGGGTGGGGGG + Intergenic
925257805 2:2505257-2505279 AAGGGATAGCAGAAGCTGGGAGG - Intergenic
925767773 2:7253556-7253578 TAGGTTTAGATGAGGTTGTGAGG + Intergenic
926054296 2:9765375-9765397 GAGTTTTAGCAGAGGCTGGGTGG + Intergenic
927057206 2:19376359-19376381 TAGGTATATTGGAGATTGGGTGG + Intergenic
927102858 2:19801208-19801230 TTGGTCTAGCAGAGGTCGGGCGG - Intergenic
928898269 2:36290360-36290382 TGGGGATAGCAGAGATTTGGAGG - Intergenic
928996537 2:37297888-37297910 TATGTATAGAAAAGGGTGGGGGG - Intronic
929119444 2:38472226-38472248 TAGGGATTGCTGAGGATGGGTGG + Intergenic
931453567 2:62388998-62389020 CAGGTACTCCAGAGGTTGGGAGG - Intergenic
932885586 2:75546390-75546412 TAGGGAAAGAAGAGGCTGGGGGG + Intronic
933971648 2:87474475-87474497 TGGGTTTAGGAGAGTTTGGGTGG - Intergenic
935500332 2:103831062-103831084 TAGAAACAGCAGAGGTTGGTGGG + Intergenic
936011160 2:108926301-108926323 TATGTAGAACAGGGGTTGGGGGG - Intronic
936322082 2:111475724-111475746 TGGGTTTAGGAGAGTTTGGGTGG + Intergenic
939671359 2:145016510-145016532 AAGGTATACCAGAAGTGGGGGGG - Intergenic
940672755 2:156690208-156690230 TGGGTAAAGAAGTGGTTGGGTGG - Intergenic
940930862 2:159428985-159429007 GAGGTATGGCAGAGCTGGGGTGG - Intronic
942406628 2:175662836-175662858 TAGCTGGAGCAGAGGTTTGGAGG + Intergenic
942773665 2:179554052-179554074 TAGCTATATCATAGGATGGGTGG + Intronic
943134081 2:183890066-183890088 TAGGTATGTCACAGGTTGTGGGG - Intergenic
943823099 2:192352674-192352696 TAGGGACAGCAGGGGTTGAGGGG - Intergenic
945557885 2:211301651-211301673 CAGCTGTAGGAGAGGTTGGGAGG + Intergenic
1170321134 20:15099296-15099318 TAGGTTTAGCTGAGGTTGTGAGG + Intronic
1170552275 20:17488424-17488446 TAGTTACAGCAGAGGCTGTGTGG + Intergenic
1170807329 20:19643986-19644008 AAGGAATAGGAGAGCTTGGGGGG + Intronic
1172686966 20:36763109-36763131 AAGGTATATCTGAGGCTGGGCGG + Intronic
1173988448 20:47280895-47280917 CAGGAAGAGCAGAGGTCGGGAGG - Intronic
1177864815 21:26500183-26500205 TAGGTTTAGATGAGGTTAGGAGG - Intronic
1178510097 21:33197898-33197920 GAGGTATGGCAGAGGATGGCTGG - Intergenic
1178961242 21:37067730-37067752 TAAGTATAGAAGAGGATAGGAGG - Intronic
1181914434 22:26268355-26268377 TAGGTAAAGCAGGGGTGGAGGGG - Intronic
1182835433 22:33337826-33337848 CAGGTATGGCAGGGGTGGGGTGG + Intronic
1182949105 22:34354807-34354829 TGGGTATTGAAGAGGTTGAGAGG + Intergenic
1183490873 22:38114991-38115013 GAGGTACAGCAGAGGCTGGCAGG - Intronic
1184036979 22:41922934-41922956 TAGGTGTGGGAGAGGTTTGGTGG - Intergenic
952162938 3:30713776-30713798 AAGGTAAATCACAGGTTGGGAGG + Intergenic
953018719 3:39100549-39100571 TGGGGATAGCAAAGGTAGGGAGG - Intronic
954055825 3:48023847-48023869 TGGGGATGGCAGGGGTTGGGGGG + Intronic
957823487 3:85409805-85409827 TAAGTATAGCAGAAGTTAGATGG + Intronic
961179773 3:124867407-124867429 TAGGGTTTGCAGAAGTTGGGAGG - Intronic
961948327 3:130717920-130717942 AAGGTGGAGCAGAGGTTGTGGGG + Intronic
964593622 3:158396184-158396206 TACTTACGGCAGAGGTTGGGAGG + Intronic
965063049 3:163806204-163806226 TAGGTATGCCACAGGTTGTGGGG - Intergenic
966687162 3:182708624-182708646 GAGATCTAGCAGAGGGTGGGAGG - Intergenic
969903400 4:10370903-10370925 CAGGTGAATCAGAGGTTGGGTGG - Intergenic
970610693 4:17722339-17722361 TGGGGAGAGCAGAGGTTGTGTGG + Intronic
971070181 4:23081912-23081934 TAGGCATAGAAGAGGTTGTGAGG - Intergenic
971109816 4:23572631-23572653 AAGCTATAACACAGGTTGGGTGG - Intergenic
976096450 4:81513315-81513337 GAGCTATAGCAGAGGGAGGGAGG - Intronic
978404139 4:108362013-108362035 TCAGTATATAAGAGGTTGGGTGG + Intergenic
979139488 4:117153655-117153677 TTTGTATAGAAAAGGTTGGGTGG + Intergenic
980176621 4:129353996-129354018 TAGGGATAGCAGAGGTGTGAGGG - Intergenic
980790729 4:137616200-137616222 TAGGTTTAGATGAGGTTAGGAGG + Intergenic
982685275 4:158481205-158481227 GAGTTACAGCAGAGGTTTGGAGG - Intronic
986762084 5:10889501-10889523 TGGAAATAGCAGAGGTCGGGTGG + Intergenic
987767039 5:22245499-22245521 TAAATATAGCAGAGATAGGGTGG + Intronic
991051341 5:62275598-62275620 TAGGGATAGCAGAGTTTCAGGGG - Intergenic
991215353 5:64153458-64153480 TGGGCATAGCAGAGATAGGGAGG - Intergenic
991216454 5:64161639-64161661 TGGGCATAGCAGAGATAGGGAGG - Intergenic
991911637 5:71568708-71568730 TACATATATAAGAGGTTGGGAGG - Intergenic
994564948 5:101432264-101432286 TAAGTATTGCAGTGGTTTGGGGG - Intergenic
997791911 5:136769392-136769414 GAGGTAAAGCAGTGGTTGGTGGG - Intergenic
998243390 5:140471864-140471886 TGGGCATATCAGAAGTTGGGAGG - Intronic
999331915 5:150679419-150679441 TAGGAATGGCAGAGGTAGGAAGG - Intergenic
1000374843 5:160569713-160569735 AAGGTATAGCTGAGATTAGGAGG + Intronic
1000505120 5:162107000-162107022 TTGGGAAGGCAGAGGTTGGGAGG - Intronic
1005080742 6:21954131-21954153 GAGGTTTAGCAGTGGTAGGGTGG - Intergenic
1005824339 6:29623593-29623615 TAGGCAGACCAGAGGTGGGGAGG - Intronic
1007767509 6:44169728-44169750 TTGTGATAGCAGAGGTTGGTGGG - Intronic
1011501406 6:87994325-87994347 TGGGTAGAGCAGATGTTGGTAGG + Intergenic
1011636725 6:89381465-89381487 GAGGGATAGCATGGGTTGGGAGG - Intronic
1016184319 6:141180791-141180813 TAGGTATGCCACAGGTTGTGGGG - Intergenic
1017250229 6:152272318-152272340 TAGGGAATGCAGAGGTTAGGCGG + Intronic
1022198951 7:28097132-28097154 TTAGTGTGGCAGAGGTTGGGTGG - Intronic
1029949470 7:104567861-104567883 CAGTTATAGCAGAGGTGGGAGGG - Intronic
1032011400 7:128350464-128350486 TAGGCATGGCAGAGGTGGGTAGG + Exonic
1032086489 7:128886635-128886657 CAGGTATAGCAGGAGGTGGGGGG - Exonic
1033753838 7:144380881-144380903 TAGGTATAGACTAGTTTGGGTGG + Intergenic
1036082630 8:5574144-5574166 GAGGTTTACCAGAGGTAGGGAGG + Intergenic
1039306183 8:36265857-36265879 TTGGAATAGTATAGGTTGGGAGG + Intergenic
1039555007 8:38468870-38468892 TAGACATAGCAGCGGTTTGGGGG + Intergenic
1041002214 8:53464221-53464243 TAGGTATACCACTGGTTGTGGGG - Intergenic
1042694634 8:71543282-71543304 TACCTGGAGCAGAGGTTGGGGGG + Intronic
1043268014 8:78291118-78291140 TTGGACTAGCAGAGGTTTGGGGG - Intergenic
1047202548 8:122779673-122779695 TGGGTGAGGCAGAGGTTGGGAGG + Intergenic
1047664553 8:127076360-127076382 TAGGTTTAGATGAGGTTGTGAGG + Intergenic
1047851818 8:128865439-128865461 TAGTGATAACGGAGGTTGGGGGG + Intergenic
1050993323 9:12180586-12180608 TTGTTATAGCAGAAGTTGAGAGG - Intergenic
1052533250 9:29715393-29715415 GAGGTCTAGCAGACGCTGGGAGG - Intergenic
1055015613 9:71614655-71614677 TAGTCATAGCACAGGTTGGCAGG - Intergenic
1187212333 X:17243739-17243761 TTGGGATAGTAGATGTTGGGAGG + Intergenic
1188063947 X:25634033-25634055 TAGAAATGGCAGAGGTTGGCTGG - Intergenic
1188248699 X:27864497-27864519 TGGGTATGGCAGAGGGAGGGAGG - Intergenic
1199803553 X:151274875-151274897 TAGGTAGAGCAGGTGTGGGGAGG - Intergenic
1200694825 Y:6349733-6349755 TAGGTATACCACAGGTTGTGGGG + Intergenic
1200791707 Y:7305103-7305125 TAGATAAAGCAGAAGATGGGAGG - Intergenic
1201040452 Y:9824977-9824999 TAGGTATACCACAGGTTGTGGGG - Intergenic
1201921463 Y:19238321-19238343 TAGGGATAGCAGAATCTGGGAGG - Intergenic