ID: 1107505090

View in Genome Browser
Species Human (GRCh38)
Location 13:41025971-41025993
Sequence TAGGACAGTGAAGGTATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107505090_1107505096 17 Left 1107505090 13:41025971-41025993 CCAAAAATACCTTCACTGTCCTA 0: 1
1: 0
2: 1
3: 20
4: 207
Right 1107505096 13:41026011-41026033 CCCCCTAGACCTATGTTCACAGG 0: 1
1: 0
2: 1
3: 1
4: 51
1107505090_1107505098 18 Left 1107505090 13:41025971-41025993 CCAAAAATACCTTCACTGTCCTA 0: 1
1: 0
2: 1
3: 20
4: 207
Right 1107505098 13:41026012-41026034 CCCCTAGACCTATGTTCACAGGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107505090 Original CRISPR TAGGACAGTGAAGGTATTTT TGG (reversed) Intronic
900905340 1:5552993-5553015 TAGAACAGTGAGGGTATCTGAGG + Intergenic
901085527 1:6609499-6609521 TAGGAAGGTGAAGCTATATTTGG + Intronic
903427726 1:23266822-23266844 TAGGACAGTGTAAGGATTTAGGG + Intergenic
904042805 1:27593988-27594010 TAGGAAAGAGAAGGGATTTGGGG + Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
909079599 1:71093438-71093460 TAGGACAGAGAAGATAGATTAGG + Intergenic
909691686 1:78414504-78414526 TAGGACAGGGAAGGTATCTCTGG - Intronic
910125439 1:83836824-83836846 AAAGACAGTGACAGTATTTTCGG - Intergenic
910297243 1:85661457-85661479 TAGGAAAGTGTTGTTATTTTTGG - Intronic
912619727 1:111142921-111142943 TAGGACTGTGACAGTATTATAGG + Intronic
912864495 1:113245321-113245343 TATTTCTGTGAAGGTATTTTTGG + Intergenic
913345974 1:117811538-117811560 TAGGACAGGGAAGGAGTTGTAGG - Intergenic
915824890 1:159064909-159064931 TAGGAGATTGATCGTATTTTAGG + Intronic
916562026 1:165941502-165941524 TAGCACAATGAAAGCATTTTCGG + Intergenic
919007646 1:191920046-191920068 TAGGACAGTCAATGTTATTTGGG + Intergenic
920494778 1:206446996-206447018 AAGGCCAGTGACAGTATTTTAGG + Intronic
922309277 1:224372966-224372988 TAGCACAGTGAAGGGATTTTAGG - Intronic
922932147 1:229398316-229398338 GAGGACAGTGAAGGACTTCTGGG - Intergenic
923320003 1:232822509-232822531 AAGAACAGTGAAGGGATTCTAGG - Intergenic
923440062 1:234009110-234009132 TAGGAAATTGCAGGAATTTTGGG - Intronic
924525482 1:244843965-244843987 TAGGAAAATGAAGTTATTTCTGG + Exonic
1063291792 10:4757351-4757373 AAGGAAAGTGAAGTTATGTTAGG + Intergenic
1065065078 10:21954330-21954352 TAGGCTAGTGAAGACATTTTTGG - Intronic
1066492446 10:35906778-35906800 TCGGACTGTGAAGGTCTTTGAGG + Intergenic
1069064813 10:63931158-63931180 AAGGGAAGTGAAGATATTTTGGG + Intergenic
1069070844 10:63989192-63989214 TATGAAAGTAGAGGTATTTTTGG + Intergenic
1069541828 10:69300176-69300198 AAAGACTGTGAAGGGATTTTGGG - Intronic
1070020360 10:72579070-72579092 AGGGAGAGTGATGGTATTTTAGG - Intronic
1070461507 10:76675090-76675112 TAACACAGTGAAGTTAGTTTGGG + Intergenic
1073547775 10:104366410-104366432 CAGGATAGAGATGGTATTTTAGG - Intronic
1073875480 10:107916963-107916985 TTGGGTAGTAAAGGTATTTTTGG - Intergenic
1075219633 10:120573726-120573748 AAAGACAATGAATGTATTTTAGG + Intronic
1077793213 11:5463559-5463581 TAAAACACTGAAGATATTTTGGG + Intronic
1079375411 11:19887618-19887640 TATGGCAGTGTTGGTATTTTGGG + Intronic
1079813612 11:25026946-25026968 TGGGACAGTGAATCTAATTTAGG - Intronic
1081086331 11:38806118-38806140 TAGGACCTTAAAGGTGTTTTAGG + Intergenic
1081187214 11:40058656-40058678 AAGGACAGTGGAGGTATTCTAGG - Intergenic
1084872277 11:72106249-72106271 CAAGACAGTGAAGGAATATTTGG + Intronic
1085484104 11:76847409-76847431 TAGGGAAGAGAAAGTATTTTAGG + Intergenic
1088233010 11:107692132-107692154 TAGAACAGAGAAGGTAGATTGGG + Intergenic
1092265594 12:6978159-6978181 TATGACAGTAATGGTTTTTTTGG + Intronic
1092612382 12:10186178-10186200 TAAGACATTTAAGGTAGTTTGGG - Intronic
1092659868 12:10726478-10726500 TAAGAGAGTAAAGGTATTTCAGG + Intergenic
1092952688 12:13522278-13522300 TAGGACAGTGAAGATGTGTGGGG + Intergenic
1095581062 12:43799548-43799570 AATGACAGTGAAGTTACTTTAGG + Intronic
1099122178 12:78704551-78704573 AAGTAAAGAGAAGGTATTTTAGG - Intergenic
1099349881 12:81553131-81553153 GAGGCCAGAGAAGGTATCTTAGG + Intronic
1101365454 12:104065491-104065513 AAAGACAGTGATGGAATTTTGGG + Intronic
1101412569 12:104481633-104481655 TAAGAAAGGGAAGGCATTTTTGG + Intronic
1102278580 12:111600513-111600535 TAGGACATTGAGGGGAATTTTGG - Intergenic
1105709339 13:22991479-22991501 TATGACAGTTAAATTATTTTTGG - Intergenic
1106401193 13:29432671-29432693 TTGGACAGTGAAGGGAGCTTAGG - Intronic
1107102058 13:36604225-36604247 AAGGAGAGTGAAGGTATCTCAGG - Intergenic
1107505090 13:41025971-41025993 TAGGACAGTGAAGGTATTTTTGG - Intronic
1107591021 13:41905648-41905670 TAGGACATTGAACATTTTTTAGG + Intronic
1107782150 13:43915283-43915305 TAGGACAGTTAAGGTCCTTGTGG - Intergenic
1109323543 13:60838996-60839018 TAGAAGAGTGAGTGTATTTTGGG - Intergenic
1109759705 13:66811856-66811878 TAGGCTTGTGAAGATATTTTGGG - Intronic
1109984990 13:69968511-69968533 TATGAAATTGAAGGTATTATGGG + Intronic
1111666512 13:91275369-91275391 AAGGACAATAAAGATATTTTAGG + Intergenic
1114033058 14:18593121-18593143 TACAACAGTAAAGCTATTTTGGG - Intergenic
1114472520 14:22973609-22973631 TTGGACACTGAGGGTATCTTAGG + Intronic
1114867032 14:26608412-26608434 TAGTCCAGTGAAGGCATTTTTGG - Intergenic
1115894518 14:38070853-38070875 TTGGATGGTGAAGGTCTTTTTGG + Intergenic
1116412866 14:44646203-44646225 TAGGACAGTGTAGTTCTTTTGGG - Intergenic
1118134340 14:63005000-63005022 TAGGAAAATGAAGGATTTTTTGG + Intronic
1118363539 14:65075692-65075714 TGGGACAGGGAGGGTGTTTTGGG - Exonic
1125067349 15:35504239-35504261 TAGGAGTGAGAAGGTAATTTGGG - Intronic
1126617745 15:50603040-50603062 TAGGGCAGTTAAGGTTTTTTGGG - Intronic
1126678421 15:51181771-51181793 TTGGAGAGTGCAGGTCTTTTGGG + Intergenic
1127494217 15:59494282-59494304 TAGGACAGAGTAGGGACTTTAGG + Intronic
1129280743 15:74483046-74483068 AAGGACTGTGAAGGGATTTTAGG + Intergenic
1133808284 16:9142103-9142125 TAGGAGAGGGAATGTATTTAGGG + Intergenic
1134141975 16:11728121-11728143 TAGGAAAGTTAAGGAATTTTTGG - Intronic
1135585504 16:23667725-23667747 TAGGACAGCTAAGGTCATTTTGG - Exonic
1136495934 16:30644220-30644242 TGGGACAGTCAAGGTTTTTGTGG - Intergenic
1138081801 16:54097790-54097812 TAGGACAGTGAAGGAAGATGGGG + Intronic
1138188042 16:54991766-54991788 TATGTCTGTGAAGGTGTTTTTGG - Intergenic
1139011345 16:62638470-62638492 GAGGACACTCAAAGTATTTTTGG - Intergenic
1139076998 16:63463611-63463633 TATGACTGTGATGGTGTTTTTGG - Intergenic
1140244816 16:73238587-73238609 TAGTACAGAGAAGGCATTGTGGG - Intergenic
1140990980 16:80211091-80211113 TAAAACATAGAAGGTATTTTAGG + Intergenic
1141158738 16:81614614-81614636 CAGGACTGTGCAGGTAGTTTTGG - Intronic
1144038894 17:11391083-11391105 TAGGGCAGGGCAGGTATTTCAGG + Intronic
1145830654 17:27913664-27913686 TAGGTGAGGGAAGATATTTTGGG + Intergenic
1147489173 17:40848009-40848031 TATAACAGTGAATGTATTATTGG - Intergenic
1150977771 17:70108369-70108391 GAGGTCAGGGAAGGTATGTTGGG + Exonic
1152856879 17:82669768-82669790 AAGGACTGTGAAGAGATTTTTGG - Intronic
1153552926 18:6281360-6281382 TAGGATAGTGAAGGCTTCTTTGG - Intronic
1156220902 18:35051097-35051119 GAGGACAGTGAGGGTTTCTTGGG + Intronic
1156242262 18:35266022-35266044 GAGGAAACTGAAGGTAGTTTGGG + Intronic
1157372028 18:47122684-47122706 TGTGACATTGGAGGTATTTTGGG - Intronic
1157619433 18:49007711-49007733 TGGGACAGTGAAGGTCTTCCAGG + Intergenic
1158385382 18:56984108-56984130 TAGGACAGTGAAAATTTTTAAGG - Intronic
1158821309 18:61162307-61162329 TATGTCTGTGAAGGTGTTTTTGG - Intergenic
1158861854 18:61600262-61600284 TAGGAAAATGAAGGAATTTGCGG + Intergenic
1159283085 18:66311955-66311977 TAGAAAAGTGAAAGTATTTGAGG - Intergenic
1160974241 19:1784864-1784886 CAGGACAGGGAAGGTGTTTATGG + Exonic
1161860806 19:6796811-6796833 GAAGACAATGAAGGTATTGTAGG - Intronic
1163258185 19:16170483-16170505 TATGAAAGTGAAGGTATCTTTGG - Intronic
1167170422 19:47827469-47827491 TATGAGAGTGAAGGCATTTGGGG - Intronic
1167239537 19:48335142-48335164 TAGGACAGTGGAGGTCTTCAGGG + Intronic
928855567 2:35799134-35799156 TAAGAAAGTGACGGTAATTTGGG + Intergenic
929128142 2:38539318-38539340 TAGGACACTGAGGGGACTTTGGG + Intergenic
930915030 2:56676336-56676358 TAGGAAAGTGTAGACATTTTTGG + Intergenic
931729655 2:65141664-65141686 TAGGACAGTGATGGTAATGAGGG - Intergenic
931955020 2:67413419-67413441 CAGAATAGTGATGGTATTTTTGG - Intergenic
932623123 2:73278131-73278153 TAGGACAGTGAAGCTGTCTATGG + Intronic
932710438 2:74059922-74059944 TAGGTCACTGATGGTCTTTTGGG + Intronic
932783665 2:74580573-74580595 TAGGACAGGGGAGGGCTTTTTGG - Intronic
939813808 2:146869444-146869466 TATTGCAGTGAAGGTATTTGTGG + Intergenic
940250822 2:151674219-151674241 TGTGTCAGTGAAGGTAATTTGGG + Intronic
941865858 2:170333674-170333696 AAGGAGAGTGAAGCCATTTTAGG - Intronic
943562647 2:189482382-189482404 TTAGGCAGTGAAGGGATTTTTGG + Intergenic
944006602 2:194916248-194916270 TATTTCTGTGAAGGTATTTTTGG + Intergenic
944497604 2:200324226-200324248 TAGGACCTTGAAGGTGTTTCAGG + Intronic
944847008 2:203679143-203679165 GAGGACGGGGAAGGTGTTTTAGG + Intergenic
947738674 2:232474530-232474552 TAGGAGAGTGGAGGCATATTCGG - Intergenic
1169963738 20:11191945-11191967 TTGGACACTGAAGGTTTTTGAGG + Intergenic
1170790913 20:19508762-19508784 GAGGACCTTGAAGGTATTTGGGG + Intronic
1172739215 20:37152313-37152335 AAGGACTGAGAAGGTATGTTTGG + Intronic
1172962528 20:38808464-38808486 CAGGACAGTGAAGGTTTTCCTGG - Intronic
1177750499 21:25277560-25277582 TGTGTCTGTGAAGGTATTTTGGG + Intergenic
1178216542 21:30605487-30605509 TTGGACAGTGAAGGGAATGTTGG + Intergenic
1178472767 21:32908693-32908715 AAGGACAGTGAAGGTTTCTTGGG + Intergenic
1179169147 21:38959269-38959291 TAGGACAGGGATGATCTTTTGGG - Intergenic
1181691443 22:24564231-24564253 CAGGACTGTGAAGGTGTGTTGGG - Intronic
1182954566 22:34410148-34410170 TGAGACAGTGAAGGAATCTTCGG - Intergenic
1183866258 22:40706588-40706610 GAGGAGAATGAAGGTTTTTTGGG - Intergenic
1184991447 22:48172853-48172875 TAGGTCACTGCAGGCATTTTTGG - Intergenic
949117615 3:346487-346509 GAGGTCAGTGAAGGCATTTGTGG - Intronic
950145626 3:10647697-10647719 TAGGACAGTGAAGGCATCAAAGG + Intronic
950900208 3:16490733-16490755 TTGGACATTTAAGTTATTTTGGG - Intronic
951335952 3:21421967-21421989 TAGGGGAGAAAAGGTATTTTTGG - Intronic
951616875 3:24556843-24556865 TAAGAGAGGGAAGGGATTTTTGG - Intergenic
951984885 3:28607963-28607985 AAGGCCACTGAAGATATTTTTGG + Intergenic
952829903 3:37555965-37555987 TGGGAAAGGGAAGGCATTTTAGG + Intronic
953168678 3:40488027-40488049 TAGGGCAGAGCAGGTATGTTGGG - Exonic
954191071 3:48961672-48961694 TTGGACAGGTAAGGTATTTGGGG + Exonic
958007746 3:87834126-87834148 TAGGACAGGGATGATATATTTGG + Intergenic
958490639 3:94767369-94767391 TTGGACAGTGCTGGTATGTTAGG + Intergenic
960137208 3:114118046-114118068 TATGTCTGTGAAGGTATTTCCGG + Intergenic
960172248 3:114475307-114475329 TAGTACAGATAAGGTATTCTTGG - Intronic
962097384 3:132306409-132306431 TAGTAAAATGAATGTATTTTGGG - Intergenic
962389169 3:134957341-134957363 TAGGTCACTGAAGATATTATAGG + Intronic
963785794 3:149533146-149533168 TAGGAAACTGAAGGTTTGTTTGG - Intronic
964749704 3:160042936-160042958 TATGTCTGTGAAGGTATTTCCGG + Intergenic
965297025 3:166960627-166960649 TTGAACACTGAAGGTATTCTTGG - Intergenic
965513620 3:169596968-169596990 TAGGACAATGAAAGTTTTATGGG + Intronic
966199455 3:177346640-177346662 TAGGTTAGTGAGTGTATTTTAGG - Intergenic
966483913 3:180446455-180446477 TAGGGCAGGGTAGGTATGTTGGG + Intergenic
973036666 4:45415747-45415769 CAAGACAGTGAAGGTGTATTGGG - Intergenic
975655547 4:76637884-76637906 TAGGAGGGGAAAGGTATTTTAGG - Intronic
975786875 4:77899674-77899696 AAGAAAAGAGAAGGTATTTTAGG + Intronic
976068051 4:81212560-81212582 TAGGACAGTGAGTTTAATTTTGG + Intronic
976703295 4:87994193-87994215 TAGGACAGTCCAAGTGTTTTAGG + Intergenic
977860921 4:101958846-101958868 AATGACAGTGCAGGTATTTTGGG + Intronic
980030551 4:127824766-127824788 TAGGTCAGTGGTGTTATTTTAGG + Intronic
980696137 4:136358486-136358508 TAGGACAGTGAGACTATTATTGG - Intergenic
980833436 4:138159194-138159216 GAAGTCACTGAAGGTATTTTGGG - Intergenic
984048359 4:174831582-174831604 TAGGCGAGTGAATGTGTTTTTGG + Intronic
985436174 4:189931382-189931404 TGGGACAGTGAAAATTTTTTAGG - Intergenic
989635887 5:43533087-43533109 TAGCACAGAGAAGTTTTTTTAGG - Intronic
993628152 5:90251021-90251043 TATGACAATTGAGGTATTTTGGG + Intergenic
993809050 5:92452803-92452825 CAGAACTGTGAAGGTATTTTCGG - Intergenic
994851845 5:105065471-105065493 TAGCACAGTGAAAATAATTTTGG - Intergenic
995229623 5:109744373-109744395 GAGGGCAGAGAAGGAATTTTAGG + Intronic
998260452 5:140627109-140627131 AAGGAAAGTGAATGTGTTTTTGG - Intergenic
998326666 5:141286914-141286936 GAGGACCGTGATGGTGTTTTAGG - Intergenic
999191065 5:149747846-149747868 GAGGACAGTGATGGTGTCTTGGG + Intronic
999811274 5:155129777-155129799 TAGGAAAGGGAAGGTATTTCAGG - Intergenic
1000149577 5:158486330-158486352 TAGGAGAGTGAAGGGCTTGTGGG + Intergenic
1000327367 5:160182539-160182561 TAGCACAGTGACTGTAGTTTTGG - Intergenic
1000994645 5:167946376-167946398 CAGCACAGTGAAGGAAGTTTGGG + Intronic
1005645423 6:27833416-27833438 TAGGATAGTGACGGTACTGTTGG + Intergenic
1006137719 6:31905951-31905973 TAAGACATTCAAAGTATTTTAGG + Intronic
1009261711 6:61498707-61498729 TAGAACTGTGAAGGGATATTTGG - Intergenic
1009764369 6:68050504-68050526 TAGGACAGTGAAACTATTATGGG - Intergenic
1009970825 6:70624008-70624030 TATGTCAGTGAAGGTATTTCTGG + Intergenic
1010650752 6:78452969-78452991 TAGCCCAGTGAAAGTAATTTTGG + Intergenic
1010755036 6:79657264-79657286 TAGGACAGTAAAGAAATTCTTGG + Intronic
1012615721 6:101277461-101277483 CAGGATAGTGAAGGTCTTTTGGG - Intergenic
1013033176 6:106356045-106356067 TAGGAGAGTGAAACTATTTGAGG - Intergenic
1014681886 6:124441338-124441360 AAGGACTGTTAAGGAATTTTTGG - Intronic
1015754980 6:136597815-136597837 TTGGACAGTGAAGCTATTGATGG - Intronic
1016553216 6:145306200-145306222 TAGGATAGTGTATGTACTTTGGG + Intergenic
1017935673 6:159002721-159002743 TAGGTCAGTGAAAGGACTTTAGG + Intergenic
1018403916 6:163456932-163456954 TAGAAGAGTGAATGTGTTTTGGG + Intronic
1019803691 7:3106933-3106955 AAGGACACTGAAGGTTTTCTAGG + Intergenic
1020397884 7:7737599-7737621 TATGACAGTTTATGTATTTTGGG + Intronic
1021386159 7:20033569-20033591 TAGGCCAAAGAAGGTATTTGGGG - Intergenic
1022179817 7:27908322-27908344 TAAGACAGTAAAACTATTTTGGG + Intronic
1022261068 7:28705414-28705436 CAGACCAGTGAAGGGATTTTTGG + Intronic
1022603636 7:31786379-31786401 TAGGAAATTGCAGGTAATTTGGG - Intronic
1023126763 7:36962068-36962090 TAGTACAGTGTGGTTATTTTAGG - Intronic
1024515504 7:50250956-50250978 TTGGACACTGAATGGATTTTAGG - Intergenic
1027442759 7:78237980-78238002 TAGGACGGAGAAGGTAGCTTTGG - Intronic
1027470437 7:78566667-78566689 TAGGACAATGAAAGTATTCATGG - Intronic
1027765023 7:82328741-82328763 TAGGACAGTGAAGGAAAATGTGG - Intronic
1027811940 7:82914676-82914698 TCAGACAGTGAAGGTAAATTGGG - Exonic
1027955431 7:84873192-84873214 TAGGGAAGTCAAGGCATTTTAGG + Intergenic
1029158405 7:98533628-98533650 TAGGAAAGAGAAGATGTTTTCGG + Intergenic
1029885911 7:103871503-103871525 TAGGACAGTCATGGATTTTTAGG + Intronic
1031425763 7:121603628-121603650 TAGGACACTGAAGTTTATTTAGG + Intergenic
1031857089 7:126936347-126936369 TAGGAAAGAGAAAGTATTTAAGG + Intronic
1037205268 8:16309972-16309994 TATGACTATGAAGGGATTTTTGG - Intronic
1037669363 8:21001138-21001160 TAAGACAGAAAAGGTATGTTAGG + Intergenic
1040464606 8:47682776-47682798 TTGGCCAGTAAGGGTATTTTGGG + Intronic
1040489545 8:47906912-47906934 GAGGCCAGTGAAGGTATTAGGGG - Intronic
1045498382 8:102727143-102727165 GAGGACAGTGAAGGGATGATAGG + Intergenic
1045738742 8:105328215-105328237 TAGCTCAGTGAATGTATTATTGG + Intronic
1045845975 8:106636751-106636773 TAGGATAGTGAAGGGAATTTTGG + Intronic
1048437209 8:134429608-134429630 GAGCACAGTAATGGTATTTTAGG - Intergenic
1049013354 8:139902927-139902949 CAGGACAGTGTAAGGATTTTAGG - Intronic
1050422411 9:5479589-5479611 TAGGGCACTGAAGGTCTTTGGGG + Intergenic
1053336408 9:37276976-37276998 TAGGAGAGAGAAGGTACTTTGGG - Intronic
1054807016 9:69405030-69405052 TAGGACAGTGAAAATTTTTTGGG + Intergenic
1059536389 9:115084828-115084850 TAGCACTGGGAGGGTATTTTGGG + Intronic
1186105399 X:6200500-6200522 TAGGTCAGTGAAAGGAATTTGGG + Intronic
1188709837 X:33381854-33381876 TATAAAAGTGAAGGTATTTCAGG + Intergenic
1188989514 X:36800748-36800770 TGTGTCTGTGAAGGTATTTTGGG + Intergenic
1190785600 X:53645193-53645215 TAGGCCAGTGAAGTTAACTTAGG + Intronic
1193532704 X:82675290-82675312 CAGGACACTCAAGGTATTTTGGG + Intergenic
1193939302 X:87660337-87660359 TATGCCTGTGAAGGTATTTATGG + Intronic
1194463374 X:94200512-94200534 TATGTCTGTGAAGGTATTTCTGG - Intergenic
1197084292 X:122454185-122454207 TAGGACAGTAAAGGTATTGCTGG + Intergenic
1197900400 X:131365590-131365612 GAGGAGAGTGAAGGTCTTTGGGG - Intronic
1198148477 X:133883032-133883054 GAGGACTGTGAAGGCATTTGGGG - Intronic
1199863020 X:151819144-151819166 TTGAACACTGAAGGTACTTTTGG + Intergenic