ID: 1107510983

View in Genome Browser
Species Human (GRCh38)
Location 13:41084706-41084728
Sequence GGAAAACCCCATAGTGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107510983_1107510987 3 Left 1107510983 13:41084706-41084728 CCATGACCACTATGGGGTTTTCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1107510987 13:41084732-41084754 TTTCTCAACATGTTAACACTGGG 0: 1
1: 0
2: 0
3: 36
4: 371
1107510983_1107510989 13 Left 1107510983 13:41084706-41084728 CCATGACCACTATGGGGTTTTCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1107510989 13:41084742-41084764 TGTTAACACTGGGTATATATGGG 0: 1
1: 0
2: 0
3: 20
4: 271
1107510983_1107510988 12 Left 1107510983 13:41084706-41084728 CCATGACCACTATGGGGTTTTCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1107510988 13:41084741-41084763 ATGTTAACACTGGGTATATATGG 0: 1
1: 0
2: 2
3: 20
4: 327
1107510983_1107510986 2 Left 1107510983 13:41084706-41084728 CCATGACCACTATGGGGTTTTCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1107510986 13:41084731-41084753 TTTTCTCAACATGTTAACACTGG 0: 1
1: 0
2: 0
3: 15
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107510983 Original CRISPR GGAAAACCCCATAGTGGTCA TGG (reversed) Intergenic
901787697 1:11635626-11635648 AAAAAACCCCAAAGTGGACAGGG - Intergenic
903603875 1:24560799-24560821 GGAAACCCCCATGAGGGTCATGG - Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
904023428 1:27486228-27486250 GTAATACCCCAGAGAGGTCAGGG - Intronic
906712314 1:47940086-47940108 GGGAAACCACATGGTGATCAGGG - Intronic
908443240 1:64176652-64176674 AGAAATGACCATAGTGGTCAGGG + Intronic
910793409 1:91074455-91074477 GCAAGACCCCAGAGTGGTCCTGG + Intergenic
913408819 1:118527527-118527549 TGAAGACCCTATAATGGTCAGGG - Intergenic
920596086 1:207271629-207271651 GAAAAAACCCAAAGTGGTCCTGG - Intergenic
1063384677 10:5608686-5608708 GGAAGGCCCCATGGAGGTCAAGG + Intergenic
1064351895 10:14584348-14584370 GGAAAACCCCAAGGTGGAAAAGG + Intronic
1065052528 10:21810503-21810525 AAAATATCCCATAGTGGTCATGG + Intronic
1067490734 10:46698963-46698985 GGAAAACCCCATTGAGCCCAGGG - Intergenic
1067603927 10:47641404-47641426 GGAAAACCCCATTGAGCCCAGGG + Intergenic
1069708985 10:70477448-70477470 AGAAAATCCCATAGTGGCCTTGG - Intergenic
1069799671 10:71074281-71074303 GGAGTGCCCCATAGCGGTCAAGG + Intergenic
1073812271 10:107164356-107164378 GGAAAAGCCCCTAGGGGTCGAGG + Exonic
1076737029 10:132463484-132463506 GAAAAATCCCATATTGGTCAGGG - Intergenic
1077111179 11:862889-862911 GGAAGACCCAACAGTGGCCAGGG - Intronic
1081077918 11:38698334-38698356 GGAAAACCCCATAGTTGACTAGG + Intergenic
1086495455 11:87400002-87400024 GGCAAACCCAATAGTGGCCATGG - Intergenic
1090867350 11:130713346-130713368 TTAAAACCCCATCGTGGACAAGG - Intronic
1098414994 12:70223346-70223368 GCAAAACCCCAGTGTGTTCAAGG - Intergenic
1098640848 12:72836905-72836927 GGAACACCCCACTGTGATCAAGG - Intergenic
1102836176 12:116062770-116062792 GGAAAACACCAAAGTGGCCCAGG + Intronic
1105693744 13:22867565-22867587 GGACAACACCATAGGAGTCAGGG - Intergenic
1107510983 13:41084706-41084728 GGAAAACCCCATAGTGGTCATGG - Intergenic
1108714646 13:53066937-53066959 GAAAAAACTCATGGTGGTCATGG + Intergenic
1113005098 13:105692031-105692053 TGAAAAGCCCATAGTGTTCACGG - Intergenic
1116528124 14:45933032-45933054 GGAAAACCCCATCTTTGCCAAGG + Intergenic
1117324199 14:54653843-54653865 GGAGAACCACATAGTGGGAAGGG - Intronic
1118594050 14:67422343-67422365 GGAAGACACCAGGGTGGTCAGGG - Intergenic
1118982947 14:70730790-70730812 GGAAGACCACATTGGGGTCAGGG + Exonic
1118995013 14:70827735-70827757 GGAAAACACCATGGTGTCCAAGG - Intergenic
1126123837 15:45277681-45277703 GGAAAACCCCAAACTCGTTAAGG - Exonic
1128007392 15:64256385-64256407 GCAAAACTCCATAGAGTTCAAGG + Intronic
1129877668 15:78987134-78987156 GGACAAACCCAATGTGGTCATGG - Intronic
1131353425 15:91722279-91722301 CTAAAATCCAATAGTGGTCAGGG + Intergenic
1134915910 16:18070828-18070850 GGCAAAGCGCATAGTGGTCAGGG - Intergenic
1135791522 16:25401021-25401043 GACAAACCCCATAGTTCTCAGGG + Intergenic
1140758807 16:78092579-78092601 GGAAAACCCTGCAGAGGTCATGG - Intergenic
1142310282 16:89308361-89308383 GGAAAGCCCCACACTGATCAAGG + Intronic
1147304094 17:39551372-39551394 GTAAAATTCCATAGGGGTCAGGG - Intronic
1152040325 17:77898781-77898803 GGAAAACCCATCAGTGGGCAGGG - Intergenic
1152863720 17:82710178-82710200 TGAAAACCCCTCAGTCGTCAGGG + Intergenic
1159813662 18:73046937-73046959 GGAAACCCCAATAGAGGCCATGG + Intergenic
1160800452 19:965181-965203 GAAAAACCCTATAGTTGGCATGG + Intronic
1161011316 19:1960590-1960612 GGAAAATCTAATAGTAGTCAGGG + Intronic
1162759239 19:12878802-12878824 AGAAGCCCCCATCGTGGTCAAGG + Exonic
1163154172 19:15431147-15431169 GGAAAACGCAATGGTGGCCATGG - Intronic
1166998310 19:46730324-46730346 GGAGGACCCCAGAGTGGCCAGGG + Intronic
927412077 2:22838006-22838028 GGAAAACCCCATAATAGGAAGGG + Intergenic
928914106 2:36453568-36453590 TCAAAACCCCATAGTGTTCTTGG + Intronic
931246634 2:60497950-60497972 GGATGACCCCATAAAGGTCAGGG + Intronic
933857348 2:86428832-86428854 GGAGAACCCCACAGTCCTCATGG + Intergenic
936034655 2:109101229-109101251 GAAAAACCCCATAGTGGGCCGGG + Intergenic
936234134 2:110729167-110729189 GGAAAATAATATAGTGGTCAAGG + Intergenic
938093847 2:128449237-128449259 GTAAAACCCCTGAGGGGTCAGGG + Intergenic
938307341 2:130264915-130264937 GGAAAACCCCACAGTGGAGTTGG + Intergenic
942295763 2:174515567-174515589 GGAAAACCCCAAAGAGGATAAGG - Intergenic
942478948 2:176361567-176361589 GAACAACCCCATGGTGTTCAAGG - Intergenic
943850117 2:192708795-192708817 GATAAACCCCATAGTTGACAAGG + Intergenic
945393779 2:209297461-209297483 CAAAAACCCTGTAGTGGTCAGGG + Intergenic
945549889 2:211208504-211208526 CAAAAACCCTATAGTGTTCAAGG + Intergenic
1169840055 20:9926026-9926048 GGAGAATACCACAGTGGTCAGGG + Intergenic
1171570250 20:26242998-26243020 GAAAAAACCCACAGTGTTCAAGG + Intergenic
1173537075 20:43823676-43823698 GGCCAACCCAATAGTGCTCATGG - Intergenic
1179980770 21:44894605-44894627 GGAAACCCCCACAGTGGACTTGG - Intronic
1181167750 22:20992571-20992593 GGAGACCCTCAGAGTGGTCAGGG - Intronic
1184410214 22:44321979-44322001 GCAAAACCACATGGTGGTGAAGG + Intergenic
952847095 3:37697012-37697034 GGAAAATCTCAAAATGGTCAGGG + Intronic
953377345 3:42440016-42440038 AGAAAACACCCTAGTGGCCATGG + Intergenic
957004347 3:74926927-74926949 GGAAAACCCCATAGTAAAGATGG - Intergenic
957109224 3:75931209-75931231 GAAAAAACCCACAGTGTTCAAGG - Intronic
958954364 3:100451343-100451365 GGGAAAACCCAAAGTGGGCAGGG + Intronic
958970755 3:100607923-100607945 GGAAACCCCCATAGTGTTTGGGG + Intergenic
961130735 3:124464871-124464893 AAAAAACCTCATAGTGGTCAAGG + Intronic
965066497 3:163857024-163857046 TAAAAATCCCATAGTGGACATGG - Intergenic
970702232 4:18755812-18755834 GGAAAACCCTAAAATGATCATGG - Intergenic
971301998 4:25449687-25449709 GGAATACCACATAGTCATCACGG + Intergenic
973567483 4:52202713-52202735 TGAAAACTCTGTAGTGGTCAAGG - Intergenic
976487914 4:85629881-85629903 AGAAAACCCCAAATTTGTCAAGG - Intronic
977712999 4:100148936-100148958 GGACCAATCCATAGTGGTCAGGG + Intergenic
977929769 4:102737875-102737897 TGAGAACCCCATAGTGGCCATGG + Intronic
986093431 5:4533666-4533688 GGAAATTCCCATAGTAGTCTGGG - Intergenic
997973766 5:138426241-138426263 GTAAACCCCCATAATGGACAAGG - Intronic
1003346266 6:5270738-5270760 GGTAAGCGCCATAGTCGTCAGGG - Intronic
1004338934 6:14790015-14790037 GGAAAGGCCCAGAGTGCTCAGGG + Intergenic
1009876150 6:69507830-69507852 GACAAACCCCATATGGGTCAAGG - Intergenic
1010566231 6:77417645-77417667 GGAAAACCCCATTTTGGTGGGGG - Intergenic
1014845866 6:126276315-126276337 AGGAAACCCCATAGAGGACAAGG + Intergenic
1024218389 7:47267128-47267150 GGAACAAACCAGAGTGGTCATGG - Intergenic
1025872843 7:65450952-65450974 GAAAAACACAATAGTAGTCATGG - Intergenic
1031748396 7:125536495-125536517 TGAAAACTCGATAGTGGGCAGGG - Intergenic
1033605988 7:142928920-142928942 GGAAGACCCCAGAGTGGGGATGG - Intronic
1034351810 7:150420759-150420781 AGAAGACCCCATAATGGCCAAGG - Intergenic
1034710175 7:153184365-153184387 GGAAAACACCAGAGTGCTTAGGG - Intergenic
1036216446 8:6883702-6883724 GGAAGCCCCCATAGGGGTGAGGG - Intergenic
1036700894 8:11013277-11013299 AGAAAACCACATGGTGGTGAAGG - Intronic
1038302451 8:26366079-26366101 GGAAAACTCCATTCTGGGCATGG - Intronic
1038856985 8:31344684-31344706 GGAAAACAACATCCTGGTCATGG + Intergenic
1038982775 8:32777518-32777540 GGAAAACACCATAGTGAAGAGGG + Intergenic
1039882504 8:41633761-41633783 GGACAACTCCATAGAGGGCAGGG + Intergenic
1040023346 8:42759920-42759942 TGGAAACCCCATGGTGGCCAAGG - Intronic
1043217842 8:77618233-77618255 AGAAAACCTCTTAGTGGTCTGGG - Intergenic
1185450154 X:277292-277314 GGGACACCCCTCAGTGGTCAGGG + Intronic
1185450184 X:277372-277394 GGGACACCCCTCAGTGGTCAGGG + Intronic
1185450385 X:277969-277991 GGGACACCCCTCAGTGGTCAGGG + Intronic
1185450465 X:278199-278221 GGGACACCCCTCAGTGGTCAGGG + Intronic
1192037502 X:67580657-67580679 AGAAAAAACCAGAGTGGTCAGGG - Intronic
1192251930 X:69421054-69421076 GGCAAACCCCTAAGTGATCAAGG - Intergenic
1194369566 X:93055689-93055711 TAAAAACTCCATGGTGGTCAGGG - Intergenic
1196903664 X:120410998-120411020 TAAAAATCCCATAGTGGACATGG + Intergenic
1200677758 Y:6171901-6171923 TGAAAACTCCATGGTGGTCAGGG - Intergenic