ID: 1107510986

View in Genome Browser
Species Human (GRCh38)
Location 13:41084731-41084753
Sequence TTTTCTCAACATGTTAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 266}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107510980_1107510986 8 Left 1107510980 13:41084700-41084722 CCCTCTCCATGACCACTATGGGG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1107510986 13:41084731-41084753 TTTTCTCAACATGTTAACACTGG 0: 1
1: 0
2: 0
3: 15
4: 266
1107510984_1107510986 -4 Left 1107510984 13:41084712-41084734 CCACTATGGGGTTTTCCGTTTTT 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1107510986 13:41084731-41084753 TTTTCTCAACATGTTAACACTGG 0: 1
1: 0
2: 0
3: 15
4: 266
1107510983_1107510986 2 Left 1107510983 13:41084706-41084728 CCATGACCACTATGGGGTTTTCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1107510986 13:41084731-41084753 TTTTCTCAACATGTTAACACTGG 0: 1
1: 0
2: 0
3: 15
4: 266
1107510982_1107510986 7 Left 1107510982 13:41084701-41084723 CCTCTCCATGACCACTATGGGGT 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1107510986 13:41084731-41084753 TTTTCTCAACATGTTAACACTGG 0: 1
1: 0
2: 0
3: 15
4: 266
1107510978_1107510986 9 Left 1107510978 13:41084699-41084721 CCCCTCTCCATGACCACTATGGG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1107510986 13:41084731-41084753 TTTTCTCAACATGTTAACACTGG 0: 1
1: 0
2: 0
3: 15
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107510986 Original CRISPR TTTTCTCAACATGTTAACAC TGG Intergenic
903878354 1:26491669-26491691 TTTTCTCAACCTGTCCACAAAGG + Intergenic
904195793 1:28784555-28784577 TTTTTTTAACATGATAACAACGG - Intergenic
906082123 1:43099316-43099338 TTTTCTCAAGTTGTTAAAACTGG + Intergenic
908291649 1:62673084-62673106 GTTCCTAAACATTTTAACACGGG - Intronic
911956324 1:104240143-104240165 CTCTGTCAATATGTTAACACAGG - Intergenic
912577522 1:110686884-110686906 TCTTCTCAACATGATAGCAGAGG - Intergenic
913206247 1:116541915-116541937 TTTCCCCAACCTCTTAACACTGG - Intronic
914453448 1:147813559-147813581 TTTTCTCAAAATGTCAGCAAAGG - Intergenic
916457436 1:164985396-164985418 TATTCTAAACAAATTAACACAGG - Intergenic
916771267 1:167911029-167911051 TTTGCTAAAGTTGTTAACACTGG + Intronic
916983069 1:170160823-170160845 CTTTCTGAACATCTTAAAACCGG - Intronic
918301251 1:183206181-183206203 TTCTCACAACATTTTAACATGGG - Intronic
918909618 1:190549462-190549484 TTTTCTCATCATTTAAACAACGG + Intergenic
919836310 1:201576026-201576048 GTTTTGCAAGATGTTAACACTGG - Intergenic
920931666 1:210394541-210394563 TCTTCTCAAAAAGTTCACACGGG - Intronic
923083505 1:230683120-230683142 TTTTCTCAAGCTGCCAACACAGG + Intronic
923181368 1:231523082-231523104 TTTTCTCAACAGCTCAAGACTGG + Intergenic
1064145846 10:12825833-12825855 TTTTTTTAACATGTAATCACTGG + Intronic
1064343669 10:14509894-14509916 TTTACCCAACATATTAACAGTGG - Intergenic
1064520487 10:16195838-16195860 TGTTCTCAACATGTATACATGGG + Intergenic
1064837843 10:19554658-19554680 TATCCTCAGCATGCTAACACAGG - Intronic
1065500653 10:26378939-26378961 ATTTCACAATATGTAAACACTGG + Intergenic
1067207862 10:44234851-44234873 TTTTCTCAACATGTAAAACTGGG + Intergenic
1067269571 10:44778375-44778397 TATTCTCAACATGTTACCTATGG - Intergenic
1069026189 10:63544836-63544858 TCTTCTCAAAATCTTAACATAGG - Intronic
1069627281 10:69876049-69876071 TTTTCTCAACCTCTGAGCACCGG - Intronic
1069700711 10:70423189-70423211 GTTTCTCAACTTCCTAACACTGG - Exonic
1070002281 10:72388263-72388285 TTTTCTCAACATCAAAATACAGG - Intronic
1070283377 10:75066484-75066506 TTTCCCCAAAATATTAACACTGG + Intergenic
1071971389 10:90911378-90911400 TATTCTCAGCAAATTAACACAGG + Intergenic
1075182871 10:120227716-120227738 TTTTCCAAATATGTTAACACAGG + Intergenic
1079954415 11:26844832-26844854 TCTTATCTACATGTGAACACTGG + Intergenic
1080068116 11:28043786-28043808 ATTCATCAAAATGTTAACACAGG + Intronic
1082061343 11:47863000-47863022 TGTTGTCAACATGTTAACAGTGG + Intergenic
1082681983 11:56185264-56185286 TATTCTAAGCATATTAACACAGG - Intergenic
1082967568 11:58982478-58982500 TTGTTTCACCATGTTTACACTGG + Intronic
1087899842 11:103627968-103627990 ATTTCTCACCTTGCTAACACTGG + Intergenic
1089012049 11:115139479-115139501 TTTTCTCTACATTTTATCAGAGG - Intergenic
1093032995 12:14306067-14306089 TTTTATCAAGATGTTAAAAACGG + Intergenic
1093663193 12:21781218-21781240 TTTTCTAAACAAGTTCACACTGG + Intergenic
1093839553 12:23880430-23880452 TTTTATGAACATTTTAACATAGG + Intronic
1098616439 12:72530496-72530518 TTTTCTCAACCTCTAAATACTGG + Intronic
1098759540 12:74405638-74405660 TTTTCTTAGTATGTTACCACAGG - Intergenic
1099159711 12:79225594-79225616 TTTTATCAAAATGTTTACATAGG + Intronic
1099836435 12:87912945-87912967 TGTTCTAAACAAATTAACACAGG + Intergenic
1103703015 12:122857629-122857651 GTTTCTCAACAGGGTAACAGAGG - Intronic
1106063102 13:26314781-26314803 TTTTCTCCATATGTTTATACAGG + Intronic
1106360140 13:29023682-29023704 TTTTCAAAACATGTTAGCAAAGG - Intronic
1106445857 13:29829864-29829886 TTTTCTTAAAATGTTAAGAATGG + Intronic
1106902312 13:34366856-34366878 CATTCTCAACAAATTAACACAGG + Intergenic
1107510986 13:41084731-41084753 TTTTCTCAACATGTTAACACTGG + Intergenic
1108976735 13:56453690-56453712 TTTTCTCAGCAAACTAACACAGG - Intergenic
1109372039 13:61435291-61435313 ATTTCTTATCATATTAACACAGG + Intergenic
1109466660 13:62742884-62742906 TATTCACAACATTTTAACTCAGG + Intergenic
1112039529 13:95532646-95532668 TTTTGTGAACATGTTATCATGGG - Intronic
1112393651 13:99008671-99008693 TTTTCTCACCATTCTAAGACTGG + Intronic
1113234920 13:108261698-108261720 TTTTCTCAGCATTTTAACCTAGG + Intronic
1113717691 13:112524757-112524779 TTATCTCACCATGGTAACTCAGG - Intronic
1114382700 14:22224772-22224794 TATTCTAAACAAATTAACACGGG - Intergenic
1115052235 14:29077078-29077100 TTATCTCAACATTTTAAAAAGGG + Intergenic
1115214510 14:31001562-31001584 TTTTCTCAAAATGTGAATTCAGG - Intronic
1115677743 14:35698622-35698644 TTTTCTAAACATGTCAAGAATGG + Intronic
1116238807 14:42314179-42314201 TATTCCCAACATGTTACCATTGG + Intergenic
1116247547 14:42435340-42435362 CATTCTCAGCAAGTTAACACAGG + Intergenic
1116495940 14:45560224-45560246 TTCTTGCAACATGTTAATACTGG - Intergenic
1116989130 14:51255080-51255102 TTTTCTACACATGGTAATACAGG + Exonic
1117465209 14:55986409-55986431 TTTTCTCAGCAGGTTTACACAGG + Intergenic
1117536597 14:56708457-56708479 ATTTCAAAAGATGTTAACACTGG + Intronic
1120342567 14:83240774-83240796 TGTTCTAACCATGTAAACACAGG - Intergenic
1120410876 14:84153961-84153983 TTTTCACAGCATGATAACAGGGG + Intergenic
1120489076 14:85153557-85153579 TTTTGTAAGCATGTTAATACTGG - Intergenic
1120610034 14:86628260-86628282 TTTTCTCAGCAAACTAACACAGG - Intergenic
1120783547 14:88509188-88509210 TTTTCTCAACAGGTAATTACTGG + Intronic
1121876875 14:97460847-97460869 CTTTCTGTACATTTTAACACTGG - Intergenic
1123501762 15:20892135-20892157 TTTTTTGAACATGTTATCTCTGG - Intergenic
1123559015 15:21465834-21465856 TTTTTTGAACATGTTATCTCTGG - Intergenic
1123595245 15:21903115-21903137 TTTTTTGAACATGTTATCTCTGG - Intergenic
1125815353 15:42579360-42579382 ATTTCTCACCTTCTTAACACTGG + Intronic
1126332381 15:47547184-47547206 TTTTCCCTACATGTTAAGACTGG - Intronic
1126571043 15:50150948-50150970 TTTTCCCAAGATGTTAGGACAGG - Intronic
1127780597 15:62310801-62310823 TTTTCATAACAGGTTAATACTGG - Intergenic
1128560495 15:68662938-68662960 TTTCCTAAACAGGCTAACACAGG + Intronic
1128823388 15:70683760-70683782 ATTTCTCAAAATGTTAACAGAGG + Intronic
1129426989 15:75470640-75470662 TTTTCTCACCTTGTTGAAACAGG - Intronic
1129601629 15:77002336-77002358 GCTTCCCTACATGTTAACACTGG + Intronic
1130073309 15:80667263-80667285 TTTTCTTGAAATGTTAACAAAGG - Intergenic
1132152160 15:99469909-99469931 TTTTCTCAAAAAATTAAAACTGG - Intergenic
1202967364 15_KI270727v1_random:192993-193015 TTTTTTGAACATGTTATCTCTGG - Intergenic
1133676122 16:8074316-8074338 TTTTCTGAACATGTTAATCAGGG + Intergenic
1135801084 16:25496662-25496684 TCTTGTCAACATGTAAAAACAGG + Intergenic
1137341533 16:47611878-47611900 TTTTCATCACATATTAACACAGG - Intronic
1141931124 16:87203663-87203685 TTTTCTGATCATTGTAACACTGG - Intronic
1147013347 17:37469831-37469853 TGTTTTCTACATGTTAACAAAGG - Intronic
1149261289 17:54882598-54882620 CTTGCTCAACATGTTGAAACAGG + Intergenic
1149838291 17:59934598-59934620 CTTTCTGAACATGTTACCAGTGG + Intronic
1153936085 18:9924044-9924066 GTTTATCAAAATGTTAACAGAGG - Intronic
1155739119 18:29264693-29264715 TATCCTCAACAAATTAACACAGG + Intergenic
1157310690 18:46550692-46550714 TTTGCTCAGCATGTTCACTCAGG - Intronic
1158035211 18:53020415-53020437 TTTTATGAACATGTTAATATAGG - Intronic
1158195336 18:54878827-54878849 CTTTCTCAATAAGTTGACACAGG - Intronic
1158258690 18:55584971-55584993 TTTATTCCCCATGTTAACACTGG + Intronic
1158568498 18:58575962-58575984 TTTTCTCAGCATGCTAAAAACGG + Intronic
1159374318 18:67572958-67572980 ATATCTCAAAATGTTAAGACTGG - Intergenic
1160666042 19:329126-329148 TTCTCTCAAGATGTTAGCACTGG + Intronic
1162918736 19:13888220-13888242 TTTTTTTAACATCTCAACACAGG + Intronic
1163881607 19:19928045-19928067 TATCCAAAACATGTTAACACAGG - Intronic
1165665882 19:37627581-37627603 TATTCTAAGCAAGTTAACACAGG - Intronic
1165915131 19:39253947-39253969 TTTTCGCAAGATGTTACCATTGG + Intergenic
1166712322 19:44945296-44945318 TTTTATGAACATTTTAACCCTGG - Exonic
1168632342 19:57967336-57967358 GTTTTTTAACATGTGAACACTGG + Intronic
929330909 2:40679534-40679556 CTTTCTAAAAATGTTTACACAGG - Intergenic
932617146 2:73240070-73240092 TTTTCTCATCTTGATAACAATGG - Intronic
933385061 2:81599840-81599862 TGTTCTCAACATGTCTTCACAGG + Intergenic
935390484 2:102547022-102547044 CTTTCTCAATATGCTAACTCTGG + Intergenic
937389670 2:121473850-121473872 TATTCTTAACATGTTTTCACTGG - Intronic
938016650 2:127872855-127872877 TTTTCTAACCATGTTACCCCAGG + Intronic
940661054 2:156545482-156545504 TATTCTCAACATTTCAACAGTGG + Intronic
940747028 2:157578809-157578831 ATTTATTAACATGTTAACCCAGG - Intronic
941629085 2:167864556-167864578 TTTTATTAACAAGTTAATACAGG - Intergenic
942872244 2:180749210-180749232 TTTCATCCACATGTTGACACTGG - Intergenic
943544545 2:189258539-189258561 TTTGCTTAACATGATAACTCTGG + Intergenic
943874661 2:193049298-193049320 TTTTGTCAGCAGGATAACACAGG - Intergenic
945749006 2:213756631-213756653 TTTTCCAAACATGTTAATATGGG + Intronic
946879980 2:224167652-224167674 ATTTCTCACCATGATATCACAGG + Intergenic
946941056 2:224770635-224770657 TCTTCTCAACAGGTTAATGCTGG - Exonic
1172521878 20:35572471-35572493 TTCTGTGAACATGTTTACACTGG - Intergenic
1173881741 20:46418882-46418904 CTTTCTCAACAGGGTACCACTGG + Intronic
1174178807 20:48662146-48662168 TTTTCTCAAAAAGGTAACAGGGG - Intronic
1174752931 20:53129911-53129933 TTTTCTGAAATTGTCAACACAGG - Intronic
1177054292 21:16280676-16280698 TTTTCTGAACTTGTTGAAACTGG + Intergenic
1177088492 21:16736835-16736857 TATTCTCAACAAACTAACACAGG + Intergenic
1177228751 21:18291639-18291661 TTTTATCAGTATGTTAATACTGG - Intronic
1177686904 21:24448873-24448895 ATTACTCAAGATGTTAACAAGGG + Intergenic
1178070484 21:28960516-28960538 TTATCCCAACATGTTAAAAATGG - Exonic
1183554864 22:38517266-38517288 ATTTTTCAAGATGTTAAAACAGG + Intergenic
1183707368 22:39482519-39482541 TTTTCTCCATCTGTTAAAACAGG + Intronic
949351386 3:3127437-3127459 TTTTCTCTGCAGGTTTACACCGG + Intronic
949767227 3:7540173-7540195 TTTTTTCAAAATGTTAAAAATGG + Intronic
951459217 3:22931268-22931290 TATTCTCAACAAACTAACACAGG + Intergenic
952920449 3:38280415-38280437 TTTTCTCAACCTGTAACCAAGGG + Intergenic
953887035 3:46719993-46720015 TTTTCTCTACAGGTTGACTCTGG - Exonic
954531755 3:51327006-51327028 ATTTCTCAACCTGTAATCACTGG + Intronic
956979586 3:74620453-74620475 TTTTCTCAACATATCAACTAAGG - Intergenic
959861423 3:111219778-111219800 GTTTTTCAAGATGTTACCACTGG - Intronic
959976300 3:112463735-112463757 TTTTCTCAAATTGTGGACACTGG + Intergenic
964465257 3:156984748-156984770 TTTTCTAAGCAAGCTAACACAGG + Intronic
964467318 3:157009267-157009289 TTGTCTTAAAATGTTATCACAGG + Intronic
965464328 3:169008391-169008413 GTTTCTCAAGATGTTGTCACAGG + Intergenic
966545469 3:181141927-181141949 TATTCTCAACATGTAAACATTGG + Intergenic
966618523 3:181938802-181938824 TTTCCTAAACAAATTAACACAGG + Intergenic
967531367 3:190552358-190552380 TTTAGTCAATATGTTCACACAGG + Intronic
967650379 3:191978262-191978284 TATTCTTAGCAAGTTAACACAGG + Intergenic
968000903 3:195205919-195205941 TTTTTGCAAGATGTTACCACTGG + Intronic
971525481 4:27612397-27612419 TTTTATCAACATGTTTTCAATGG + Intergenic
971973097 4:33646555-33646577 TTATCTCAACATCTTACTACCGG - Intergenic
973690776 4:53428492-53428514 TTTTCAAAACAAATTAACACTGG - Intronic
974122979 4:57662542-57662564 TTTTCACAACGTGTTAACTGAGG + Intergenic
974175236 4:58314200-58314222 TTTACTCAAGAGGTTACCACTGG - Intergenic
974700315 4:65435116-65435138 TATTATCCACATTTTAACACTGG + Intronic
975044749 4:69787621-69787643 GTTTTGCAACATGTTACCACTGG - Intronic
975275824 4:72499891-72499913 TGTTCTAAACAAATTAACACAGG - Intronic
975899112 4:79129196-79129218 TTTTCTCCAAATTTTCACACTGG - Intergenic
976558130 4:86473062-86473084 TTTTCTCCCCCTGTTAACAGTGG - Intronic
976711625 4:88078128-88078150 GTTTCTCAGCATTTTACCACAGG - Intergenic
978328377 4:107585061-107585083 TATCCTCAACAAGCTAACACAGG + Intergenic
980255147 4:130370867-130370889 CTTCCTCAACATTTTAACAAGGG - Intergenic
980261516 4:130455439-130455461 CTTTCTCAGCAAGCTAACACAGG - Intergenic
980517956 4:133889453-133889475 CTTTCTCAACATATTAAAATGGG - Intergenic
982016756 4:151162262-151162284 CATTCTCAGCATGCTAACACAGG - Intronic
982593700 4:157350557-157350579 TTTTTTCTCCATGTAAACACTGG - Intronic
983346396 4:166531088-166531110 TTTACTTAAAATGTTATCACTGG - Intergenic
983585251 4:169347403-169347425 TTTTCTCTACAGGTTAAAGCTGG - Intergenic
983597521 4:169487428-169487450 TATTCTCAACAGACTAACACAGG - Intronic
983897873 4:173101035-173101057 TTTTCTTAACTTTTTAACATAGG - Intergenic
984279663 4:177654150-177654172 TTCTCTCAATATGTTATCATTGG - Intergenic
987228218 5:15865841-15865863 TTTTTTCAACATGTAAAGAAAGG - Intronic
988116544 5:26899526-26899548 CATTCTCAACAAATTAACACAGG + Intronic
988644541 5:33079903-33079925 TTTTATCAGCATTTTAACATTGG + Intergenic
988653803 5:33184504-33184526 TTTTATCTAAATGTAAACACTGG + Intergenic
989136317 5:38158703-38158725 TATTCTCAGCAAGCTAACACAGG - Intergenic
989702743 5:44289810-44289832 GTTTTTCAAGATGTTACCACTGG + Intergenic
989762620 5:45036527-45036549 CTTTATAAACATGTTAACTCAGG + Intergenic
989998957 5:50870242-50870264 TTTTCTCTCCATATAAACACTGG + Intergenic
990072935 5:51807272-51807294 ATTTCTAAACAGGTTAACAGTGG + Intergenic
990233172 5:53737330-53737352 TATTCTCAGCAAATTAACACAGG + Intergenic
990362061 5:55030612-55030634 TTTTGTCAACATTTTTATACAGG + Intronic
990983789 5:61623751-61623773 TTTAATCAACAAGTTAACAAAGG - Intergenic
991735150 5:69625009-69625031 TTTCCTCAAAAAGTTAAAACAGG - Intergenic
991769940 5:70030932-70030954 TTTCCTCAAAAAGTTAAAACAGG + Intronic
991779828 5:70121710-70121732 TTTCCTCAAAAAGTTAAAACAGG + Intergenic
991811584 5:70480145-70480167 TTTCCTCAAAAAGTTAAAACAGG - Intergenic
991849235 5:70906351-70906373 TTTCCTCAAAAAGTTAAAACAGG + Intronic
991859115 5:70997139-70997161 TTTCCTCAAAAAGTTAAAACAGG + Intronic
991872275 5:71122031-71122053 TTTCCTCAAAAAGTTAAAACAGG + Intergenic
995820262 5:116221938-116221960 TTTTCACAACCTGCTAAAACAGG - Intronic
996187357 5:120493550-120493572 GTTTTTCAAGATGTTACCACTGG - Intronic
996791330 5:127296839-127296861 TTTTCTCAAGATGTCAATAGGGG - Intronic
997907128 5:137829276-137829298 TTTTCTAAAAAAGTTAACACAGG + Intergenic
998309744 5:141116760-141116782 TTTTGTCATCATGTTAATACTGG - Intronic
999541524 5:152579382-152579404 TTTTCTAAGCAAATTAACACAGG - Intergenic
1001011234 5:168100610-168100632 TATTCTCAACAAACTAACACAGG + Intronic
1001722813 5:173870421-173870443 TTTTCACGATATGTTACCACTGG + Intergenic
1002830648 6:817381-817403 GTTTTTCAAAATGTTACCACTGG - Intergenic
1004282226 6:14290133-14290155 TTTTCCTCACAAGTTAACACTGG - Intergenic
1007450615 6:41938663-41938685 TGTTCTCCACCAGTTAACACTGG - Intronic
1008179491 6:48310698-48310720 TTTTTTCAATATTTTAATACAGG - Intergenic
1008817452 6:55585881-55585903 TTTTCTTAAGATGTTGCCACAGG - Intergenic
1011002828 6:82610155-82610177 TTTTGTCAGCATGTTAGGACTGG - Intergenic
1011405828 6:87014680-87014702 TATTCTCAACAAACTAACACAGG + Intronic
1013467200 6:110428176-110428198 ATTTCTCAAAATGAAAACACTGG + Intronic
1013735383 6:113221406-113221428 TTTTCTGAACATGCTAATAAAGG - Intergenic
1015395848 6:132733830-132733852 TATCCTCAGCAAGTTAACACAGG + Intronic
1016090328 6:139970193-139970215 TTTTCTCAGCAAACTAACACAGG + Intergenic
1016258463 6:142138328-142138350 TTTTCTCTACATGAAAGCACAGG + Intergenic
1017970162 6:159305172-159305194 TTTTCTGAGAATGTTAATACTGG - Intergenic
1018164473 6:161080224-161080246 TTTTCTCAACAGGTTTGCAATGG - Intronic
1019117950 6:169780509-169780531 ATTTCTCAAAATGTTAACAGCGG - Intronic
1020676966 7:11194433-11194455 TTTAGTCAATATGTTCACACAGG - Intergenic
1021344128 7:19502512-19502534 TTATCTCAGCAAATTAACACAGG + Intergenic
1021416789 7:20395632-20395654 TTTTCACAACATCTTAACAGAGG - Intronic
1024793575 7:52994998-52995020 TTTTCTCAACATGAAAAGAAGGG + Intergenic
1028464089 7:91129686-91129708 TTTTATCAACAAATTAATACTGG - Intronic
1028657605 7:93228475-93228497 TGATTTCAACATGTTTACACAGG + Intergenic
1029220134 7:98982120-98982142 TTTTCTCAACGTTTTAACTGTGG - Intronic
1029986036 7:104924138-104924160 CCTTCTCAACATTTTAAAACCGG + Intergenic
1030973471 7:116090843-116090865 TATTCTCAACAAACTAACACAGG + Intronic
1032783314 7:135181987-135182009 TTTTCGCAACATTTCAAGACAGG + Intergenic
1033014147 7:137654546-137654568 TCTTTTCAACATGTGCACACTGG - Intronic
1037092698 8:14942742-14942764 GGTTCTCAACATGGCAACACTGG - Intronic
1038139916 8:24833340-24833362 TGTTCTCACCATGCTAACAAAGG + Intergenic
1038230338 8:25693653-25693675 TTTTCTCCACATTATGACACAGG + Intergenic
1039333725 8:36567201-36567223 TATTCCCAACAGGCTAACACAGG - Intergenic
1039778936 8:40764593-40764615 TCTTCTCAATCAGTTAACACTGG + Intronic
1041281647 8:56216193-56216215 TTTTCTGAATATGTGATCACAGG - Intronic
1041368811 8:57137400-57137422 TTTTCTCATCATCATACCACAGG - Intergenic
1041525276 8:58798460-58798482 TTTTCTTCTTATGTTAACACAGG + Intergenic
1042107099 8:65339517-65339539 TTTTTACAAAATGTTAACCCAGG - Intergenic
1042824203 8:72963718-72963740 TTTATTTAACATGTTTACACAGG + Intergenic
1044980505 8:97711557-97711579 GTTTTTTAACATGTTACCACTGG - Intronic
1045275713 8:100703510-100703532 TTGTCTTGACATGGTAACACTGG + Intronic
1047446263 8:124922807-124922829 GTTTGGCAACATGTTACCACTGG + Intergenic
1048249035 8:132843020-132843042 TTTTCTCTACAGGAAAACACTGG + Intronic
1050226398 9:3462084-3462106 TTTTTTAAACAGGGTAACACTGG - Intronic
1051491282 9:17669188-17669210 GTTTTTCAAGATGTTACCACTGG - Intronic
1051963052 9:22791348-22791370 GTTTTGCAAAATGTTAACACTGG + Intergenic
1051998925 9:23252730-23252752 TATTCTCAGCAAATTAACACAGG + Intergenic
1052019889 9:23513367-23513389 TCTTCTTAAAATGTTAACAGAGG + Intergenic
1052118952 9:24684899-24684921 TTTTTCCAACATTTTAAGACAGG - Intergenic
1052135941 9:24910106-24910128 ATTTCTCAAAATGTATACACAGG + Intergenic
1052784120 9:32812968-32812990 TTTTCTCATCATTTTATCTCTGG - Intergenic
1053751200 9:41257800-41257822 TTTTTTCAAAATGTTAAAGCAGG + Intergenic
1054256722 9:62822129-62822151 TTTTTTCAAAATGTTAAAGCAGG + Intergenic
1054334585 9:63793483-63793505 TTTTTTCAAAATGTTAAAGCAGG - Intergenic
1055252689 9:74327339-74327361 TTCTCTCCTCATGTTAACAGAGG + Intergenic
1055255484 9:74365114-74365136 TCTTCTCAGCAGATTAACACAGG - Intergenic
1055612419 9:78036710-78036732 TTTTATCAAGATGTTAAAAAAGG + Intergenic
1055857190 9:80703424-80703446 GTCTCTTAACATATTAACACAGG + Intergenic
1056739520 9:89242217-89242239 TTTTGTCAAGATGTTACCACTGG + Intergenic
1056953465 9:91064173-91064195 TTTTGCCAAGATGTTACCACTGG - Intergenic
1057073598 9:92121905-92121927 GTTTTGCAAGATGTTAACACTGG - Intergenic
1057142741 9:92737457-92737479 GGATCTCAGCATGTTAACACTGG - Intronic
1058268164 9:102933713-102933735 ATTTTTCAAGATGTTATCACTGG - Intergenic
1058472715 9:105297680-105297702 TTTTCTTAATATGTAAGCACAGG - Intronic
1058567284 9:106299717-106299739 TTCTCTCAACATGTGCACTCTGG - Intergenic
1059484573 9:114616965-114616987 TTTTCTCAGCATGTTCAAAAAGG + Intronic
1060085216 9:120693117-120693139 TTTTGTCAATAAGTTTACACTGG - Intronic
1061664496 9:132152587-132152609 TTATCTGAAAATGTTAGCACTGG + Intergenic
1187332993 X:18357470-18357492 TTTTTTCATAATGTTAACACAGG + Intergenic
1187397871 X:18933794-18933816 TGTCCTCAGCATGTTTACACTGG - Intronic
1188429626 X:30091714-30091736 TTTTCCTAACAGGTTACCACAGG + Intergenic
1189738329 X:44093735-44093757 TTTTCCCAAATTATTAACACAGG + Intergenic
1190571688 X:51788980-51789002 TTTTCTCAACATATTGATTCAGG + Intergenic
1193768814 X:85563965-85563987 TTTTCTCAGCAAACTAACACAGG - Intergenic
1194130612 X:90076591-90076613 TTTTCTTAACTGGTTAACAGAGG + Intergenic
1194909153 X:99617800-99617822 TCTTCTCAACAAAATAACACAGG - Intergenic
1198708073 X:139470861-139470883 TTCTTTCAAGATGTCAACACTGG + Intergenic
1199675915 X:150189326-150189348 TTTTGTCAACATGGTATCAGGGG + Intergenic
1201560962 Y:15316192-15316214 TTTTCTGAACATTTTAAAAATGG + Intergenic
1201781910 Y:17732099-17732121 TATTCTCAGCAAGCTAACACAGG - Intergenic
1201819643 Y:18173891-18173913 TATTCTCAGCAAGCTAACACAGG + Intergenic
1201854523 Y:18526955-18526977 TATTCTCAGCAAGCTAACACGGG + Intergenic
1201878798 Y:18793430-18793452 TATTCTCAGCAAGCTAACACGGG - Intronic